Human MUC5B activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	MUC5B
Locus ID	727897
Kit Components	GA118892G1, MUC5B gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: CGTGTGTTTGCTCTCGGGGA GA118892G2, MUC5B gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TGCGTGGCCTGGCCTGGCTT GA118892G3, MUC5B gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CTACATAAGCTGGGGCCCCC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Reference Data
RefSeq	NM_002458
Synonyms	MG1; MUC-5B; MUC5; MUC9
Summary	This gene encodes a member of the mucin family of proteins, which are highly glycosylated macromolecular components of mucus secretions. This family member is the major gel-forming mucin in mucus. It is a major contributor to the lubricating and viscoelastic properties of whole saliva, normal lung mucus and cervical mucus. This gene has been found to be up-regulated in some human diseases, including sinus mucosa of chronic rhinosinusitis (CRS), CRS with nasal polyposis, chronic obstructive pulmonary disease (COPD) and H. pylori-associated gastric disease, and it may be involved in the pathogenesis of these diseases. [provided by RefSeq, Jul 2010]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.