Human PGP activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	PGP
Locus ID	283871
Kit Components	GA117067G1, PGP gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GAGCGCTTCACTCCGAATGC GA117067G2, PGP gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TGGCGAAGGTGCAGGCCAAT GA117067G3, PGP gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: TTGGCTGGCAGGGCTCCAAC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Reference Data
RefSeq	NM_001042371
Synonyms	AUM; G3PP; PGPase
Summary	Glycerol-3-phosphate phosphatase hydrolyzing glycerol-3-phosphate into glycerol. Thereby, regulates the cellular levels of glycerol-3-phosphate a metabolic intermediate of glucose, lipid and energy metabolism. Was also shown to have a 2-phosphoglycolate phosphatase activity and a tyrosine-protein phosphatase activity. However, their physiological relevance is unclear (PubMed:26755581). In vitro, has also a phosphatase activity toward ADP, ATP, GDP and GTP (By similarity).[UniProtKB/Swiss-Prot Function]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.