Human STX1B activation kit by CRISPRa
CAT#: GA114367
STX1B CRISPRa kit - CRISPR gene activation of human syntaxin 1B
CNY 12,255.00
Specifications
Product Data | |
Format | 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug) |
Symbol | STX1B |
Locus ID | 112755 |
Kit Components | GA114367G1, STX1B gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: AATGAATTCAGGGAATAACC GA114367G2, STX1B gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGGGTGACGGAATGAATTCA GA114367G3, STX1B gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGAGCCAAGCGGAGATGCTA 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077 |
Disclaimer | These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc. |
Reference Data | |
RefSeq | NM_052874 |
Synonyms | GEFSP9; STX1B1; STX1B2 |
Summary | The protein encoded by this gene belongs to a family of proteins thought to play a role in the exocytosis of synaptic vesicles. Vesicle exocytosis releases vesicular contents and is important to various cellular functions. For instance, the secretion of transmitters from neurons plays an important role in synaptic transmission. After exocytosis, the membrane and proteins from the vesicle are retrieved from the plasma membrane through the process of endocytosis. Mutations in this gene have been identified as one cause of fever-associated epilepsy syndromes. A possible link between this gene and Parkinson's disease has also been suggested. [provided by RefSeq, Jan 2015] |
Documents
Resources
基因表达相关资源 |
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
KN409124 | STX1B - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. |
CNY 8,680.00 |