Human STX1B activation kit by CRISPRa

CAT#: GA114367

STX1B CRISPRa kit - CRISPR gene activation of human syntaxin 1B



  See Other Versions

CNY 12,255.00


货期*
4周

规格
    • 1 kit

Product images

经常一起买 (2)
Rabbit polyclonal anti-STX1B antibody (N-term)
    • 400 ul

CNY 6,314.00


STX1B (Myc-DDK-tagged)-Human syntaxin 1B (STX1B)
    • 10 ug

CNY 2,400.00
CNY 3,990.00

Specifications

Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol STX1B
Locus ID 112755
Kit Components

GA114367G1, STX1B gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: AATGAATTCAGGGAATAACC

GA114367G2, STX1B gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGGGTGACGGAATGAATTCA

GA114367G3, STX1B gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGAGCCAAGCGGAGATGCTA

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077

Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq NM_052874
Synonyms GEFSP9; STX1B1; STX1B2
Summary The protein encoded by this gene belongs to a family of proteins thought to play a role in the exocytosis of synaptic vesicles. Vesicle exocytosis releases vesicular contents and is important to various cellular functions. For instance, the secretion of transmitters from neurons plays an important role in synaptic transmission. After exocytosis, the membrane and proteins from the vesicle are retrieved from the plasma membrane through the process of endocytosis. Mutations in this gene have been identified as one cause of fever-associated epilepsy syndromes. A possible link between this gene and Parkinson's disease has also been suggested. [provided by RefSeq, Jan 2015]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Other Versions

Customer Reviews 
Loading...