Human STX1B activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	STX1B
Locus ID	112755
Kit Components	GA114367G1, STX1B gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: AATGAATTCAGGGAATAACC GA114367G2, STX1B gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGGGTGACGGAATGAATTCA GA114367G3, STX1B gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGAGCCAAGCGGAGATGCTA 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Reference Data
RefSeq	NM_052874
Synonyms	GEFSP9; STX1B1; STX1B2
Summary	The protein encoded by this gene belongs to a family of proteins thought to play a role in the exocytosis of synaptic vesicles. Vesicle exocytosis releases vesicular contents and is important to various cellular functions. For instance, the secretion of transmitters from neurons plays an important role in synaptic transmission. After exocytosis, the membrane and proteins from the vesicle are retrieved from the plasma membrane through the process of endocytosis. Mutations in this gene have been identified as one cause of fever-associated epilepsy syndromes. A possible link between this gene and Parkinson's disease has also been suggested. [provided by RefSeq, Jan 2015]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.