Human NLRC5 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	NLRC5
Locus ID	84166
Kit Components	GA113402G1, NLRC5 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCTCCGCCAGTGCATGGAAC GA113402G2, NLRC5 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCGGACCCAAGGACAGTCCC GA113402G3, NLRC5 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CAGCAGGGAGCGGGTGTGTT 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_001330552, NM_032206
Synonyms	CLR16.1; NOD4; NOD27
Summary	This gene encodes a member of the caspase recruitment domain-containing NLR family. This gene plays a role in cytokine response and antiviral immunity through its inhibition of NF-kappa-B activation and negative regulation of type I interferon signaling pathways. [provided by RefSeq, Oct 2011]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.