Human MOSC1 (MARC1) activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	MTARC1
Locus ID	64757
Kit Components	GA112123G1, MOSC1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TGGCTCAGCTTCCACTTGGT GA112123G2, MOSC1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GAAGGACGCACTGCTCTGAT GA112123G3, MOSC1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: TTCAGGAGCTGCCCAGCCTT 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_022746
Synonyms	MOSC1
Summary	As a component of an N-hydroxylated prodrug-converting complex required to reduce N-hydroxylated prodrugs, such as benzamidoxime. Also able to reduce N(omega)-hydroxy-L-arginine (NOHA) and N(omega)-hydroxy-N(delta)-methyl-L-arginine (NHAM) into L-arginine and N(delta)-methyl-L-arginine, respectively.[UniProtKB/Swiss-Prot Function]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.