Human PLAC8 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	PLAC8
Locus ID	51316
Kit Components	GA109735G1, PLAC8 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: CACTGATACGTCTTTTTAAT GA109735G2, PLAC8 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CAGTGTACCTAACACAATAT GA109735G3, PLAC8 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCACTTCTGCTGGATTACTC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_001130715, NM_001130716, NM_016619
Synonyms	C15; DGIC; onzin; PNAS-144

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.