Human FOXP3 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	FOXP3
Locus ID	50943
Kit Components	GA109480G1, FOXP3 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TAAATCACAGGGCCAACCCG GA109480G2, FOXP3 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TATTTTCAGATGACTCGTAA GA109480G3, FOXP3 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: TAAGTCTCATAATCAAGAAA 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Reference Data
RefSeq	NM_001114377, NM_014009
Synonyms	AIID; DIETER; IPEX; JM2; PIDX; XPID
Summary	The protein encoded by this gene is a member of the forkhead/winged-helix family of transcriptional regulators. Defects in this gene are the cause of immunodeficiency polyendocrinopathy, enteropathy, X-linked syndrome (IPEX), also known as X-linked autoimmunity-immunodeficiency syndrome. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.