Human DNMT3L activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	DNMT3L
Locus ID	29947
Kit Components	GA109332G1, DNMT3L gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCGCCCCTCCCACTGCAAAC GA109332G2, DNMT3L gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGCCAGAGGTCACCAGGCTA GA109332G3, DNMT3L gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGCTATGGGGGCAAAGAATC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_013369, NM_175867
Synonyms	MGC1090
Summary	CpG methylation is an epigenetic modification that is important for embryonic development, imprinting, and X-chromosome inactivation. Studies in mice have demonstrated that DNA methylation is required for mammalian development. This gene encodes a nuclear protein with similarity to DNA methyltransferases, but is not thought to function as a DNA methyltransferase as it does not contain the amino acid residues necessary for methyltransferase activity. However, it does stimulate de novo methylation by DNA cytosine methyltransferase 3 alpha and is thought to be required for the establishment of maternal genomic imprints. This protein also mediates transcriptional repression through interaction with histone deacetylase 1. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2012]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.