Human DNA Polymerase theta (POLQ) activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	POLQ
Locus ID	10721
Kit Components	GA107345G1, DNA Polymerase theta gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCTCATATTAACCAACCAGG GA107345G2, DNA Polymerase theta gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCCGAAAGCCATAGACTCGT GA107345G3, DNA Polymerase theta gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CACGGAGAACTCTATGGTTC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Reference Data
RefSeq	NM_006596, NM_199420
Synonyms	DKFZp781A0112; DNA polymerase eta; DNA polymerase theta; POLH; POLH, PRO0327, DKFZp781A0112; polymerase (DNA directed), theta; PRO0327
Summary	DNA polymerase that promotes microhomology-mediated end-joining (MMEJ), an alternative non-homologous end-joining (NHEJ) machinery triggered in response to double-strand breaks in DNA (PubMed:25642963, PubMed:25643323). MMEJ is an error-prone repair pathway that produces deletions of sequences from the strand being repaired and promotes genomic rearrangements, such as telomere fusions, some of them leading to cellular transformation (PubMed:25642963, PubMed:25643323). POLQ acts as an inhibitor of homology-recombination repair (HR) pathway by limiting RAD51 accumulation at resected ends (PubMed:25642963). POLQ-mediated MMEJ may be required to promote the survival of cells with a compromised HR repair pathway, thereby preventing genomic havoc by resolving unrepaired lesions (By similarity). The polymerase acts by binding directly the 2 ends of resected double-strand breaks, allowing microhomologous sequences in the overhangs to form base pairs. It then extends each strand from the base-paired region using the opposing overhang as a template. Requires partially resected DNA containing 2 to 6 base pairs of microhomology to perform MMEJ (PubMed:25643323). The polymerase activity is highly promiscuous: unlike most polymerases, promotes extension of ssDNA and partial ssDNA (pssDNA) substrates (PubMed:18503084, PubMed:21050863, PubMed:22135286). Also exhibits low-fidelity DNA synthesis, translesion synthesis and lyase activity, and it is implicated in interstrand-cross-link repair, base excision repair and DNA end-joining (PubMed:14576298, PubMed:18503084, PubMed:19188258, PubMed:24648516). Involved in somatic hypermutation of immunoglobulin genes, a process that requires the activity of DNA polymerases to ultimately introduce mutations at both A/T and C/G base pairs (By similarity).[UniProtKB/Swiss-Prot Function]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.