Human DNA Polymerase theta (POLQ) activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	POLQ
Locus ID	10721
Kit Components	GA107345G1, DNA Polymerase theta gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCTCATATTAACCAACCAGG GA107345G2, DNA Polymerase theta gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCCGAAAGCCATAGACTCGT GA107345G3, DNA Polymerase theta gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CACGGAGAACTCTATGGTTC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_006596, NM_199420
Synonyms	DKFZp781A0112; DNA polymerase eta; DNA polymerase theta; POLH; POLH, PRO0327, DKFZp781A0112; polymerase (DNA directed), theta; PRO0327
Summary	DNA polymerase that promotes microhomology-mediated end-joining (MMEJ), an alternative non-homologous end-joining (NHEJ) machinery triggered in response to double-strand breaks in DNA (PubMed:25642963, PubMed:25643323). MMEJ is an error-prone repair pathway that produces deletions of sequences from the strand being repaired and promotes genomic rearrangements, such as telomere fusions, some of them leading to cellular transformation (PubMed:25642963, PubMed:25643323). POLQ acts as an inhibitor of homology-recombination repair (HR) pathway by limiting RAD51 accumulation at resected ends (PubMed:25642963). POLQ-mediated MMEJ may be required to promote the survival of cells with a compromised HR repair pathway, thereby preventing genomic havoc by resolving unrepaired lesions (By similarity). The polymerase acts by binding directly the 2 ends of resected double-strand breaks, allowing microhomologous sequences in the overhangs to form base pairs. It then extends each strand from the base-paired region using the opposing overhang as a template. Requires partially resected DNA containing 2 to 6 base pairs of microhomology to perform MMEJ (PubMed:25643323). The polymerase activity is highly promiscuous: unlike most polymerases, promotes extension of ssDNA and partial ssDNA (pssDNA) substrates (PubMed:18503084, PubMed:21050863, PubMed:22135286). Also exhibits low-fidelity DNA synthesis, translesion synthesis and lyase activity, and it is implicated in interstrand-cross-link repair, base excision repair and DNA end-joining (PubMed:14576298, PubMed:18503084, PubMed:19188258, PubMed:24648516). Involved in somatic hypermutation of immunoglobulin genes, a process that requires the activity of DNA polymerases to ultimately introduce mutations at both A/T and C/G base pairs (By similarity).[UniProtKB/Swiss-Prot Function]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.