Human MAP4K4 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	MAP4K4
Locus ID	9448
Kit Components	GA106309G1, MAP4K4 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGGTGTGAGTGCGTTTCCGC GA106309G2, MAP4K4 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TTTTCCTGCCTGAGGAGGAA GA106309G3, MAP4K4 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCGCCTCCGCCTCCGCCTCC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Reference Data
RefSeq	NM_001242559, NM_001242560, NM_004834, NM_145686, NM_145687
Synonyms	FLH21957; HEL-S-31; HGK; MEKKK4; NIK
Summary	The protein encoded by this gene is a member of the serine/threonine protein kinase family. This kinase has been shown to specifically activate MAPK8/JNK. The activation of MAPK8 by this kinase is found to be inhibited by the dominant-negative mutants of MAP3K7/TAK1, MAP2K4/MKK4, and MAP2K7/MKK7, which suggests that this kinase may function through the MAP3K7-MAP2K4-MAP2K7 kinase cascade, and mediate the TNF-alpha signaling pathway. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.