Human PNR (TAAR5) activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	TAAR5
Locus ID	9038
Kit Components	GA106007G1, PNR gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TAGCTACCATAGAAAGCTGT GA106007G2, PNR gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TTTACACACCCACTACTTCC GA106007G3, PNR gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCAAAACATAGGCTGAGCTT 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Reference Data
RefSeq	NM_003967
Synonyms	PNR
Summary	Olfactory receptor specific for trimethylamine, a trace amine. Also activated at lower level by dimethylethylamine. Trimethylamine is a bacterial metabolite found in some animal odors, and to humans it is a repulsive odor associated with bad breath and spoiled food. This receptor is probably mediated by the G(s)-class of G-proteins which activate adenylate cyclase.[UniProtKB/Swiss-Prot Function]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.