Human PNR (TAAR5) activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	TAAR5
Locus ID	9038
Kit Components	GA106007G1, PNR gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TAGCTACCATAGAAAGCTGT GA106007G2, PNR gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TTTACACACCCACTACTTCC GA106007G3, PNR gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCAAAACATAGGCTGAGCTT 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_003967
Synonyms	PNR
Summary	Olfactory receptor specific for trimethylamine, a trace amine. Also activated at lower level by dimethylethylamine. Trimethylamine is a bacterial metabolite found in some animal odors, and to humans it is a repulsive odor associated with bad breath and spoiled food. This receptor is probably mediated by the G(s)-class of G-proteins which activate adenylate cyclase.[UniProtKB/Swiss-Prot Function]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.