Human KMT2D activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	KMT2D
Locus ID	8085
Kit Components	GA105405G1, KMT2D gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCTTCTTCCATCCCCCTCCC GA105405G2, KMT2D gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGCCGCCTCATTTACCGCCC GA105405G3, KMT2D gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGGCCGCGAAACTAGGACTC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Reference Data
RefSeq	NM_003482
Synonyms	AAD10; ALR; CAGL114; KABUK1; KMS; MLL2; MLL4; TNRC21
Summary	The protein encoded by this gene is a histone methyltransferase that methylates the Lys-4 position of histone H3. The encoded protein is part of a large protein complex called ASCOM, which has been shown to be a transcriptional regulator of the beta-globin and estrogen receptor genes. Mutations in this gene have been shown to be a cause of Kabuki syndrome. [provided by RefSeq, Oct 2010]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.