Human ST8SIA4 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	ST8SIA4
Locus ID	7903
Kit Components	GA105350G1, ST8SIA4 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TAGACTATCTTGGAGCTCCC GA105350G2, ST8SIA4 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TGCTTGGAGAGTAACGTCCC GA105350G3, ST8SIA4 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCTGCGCAAAGCCAATCACC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_005668, NM_175052
Synonyms	PST; PST1; SIAT8D; ST8SIA-IV
Summary	The protein encoded by this gene catalyzes the polycondensation of alpha-2,8-linked sialic acid required for the synthesis of polysialic acid, a modulator of the adhesive properties of neural cell adhesion molecule (NCAM1). The encoded protein, which is a member of glycosyltransferase family 29, is a type II membrane protein that may be present in the Golgi apparatus. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.