Human Thyroid Peroxidase (TPO) activation kit by CRISPRa

CAT#: GA104957

TPO CRISPRa kit - CRISPR gene activation of human thyroid peroxidase



  See Other Versions

CN¥ 12,255.00


货期*
4周

规格
    • 1 kit

Cited in 5 publications.

Product images

经常一起买 (2)
Anti-TPO Rabbit Polyclonal Antibody
    • 100 ul

CN¥ 1,999.00
CN¥ 3,280.00


TPO (Myc-DDK-tagged)-Human thyroid peroxidase (TPO), transcript variant 1
    • 10 ug

CN¥ 6,832.00
CN¥ 7,130.00

Specifications

Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol TPO
Locus ID 7173
Kit Components

GA104957G1, Thyroid Peroxidase gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GAGTGGCGTCCGTTCTTCGT

GA104957G2, Thyroid Peroxidase gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCCACATGCAGTCCAGCCTC

GA104957G3, Thyroid Peroxidase gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCATGTGGACCCCGATGACA

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077

Reference Data
RefSeq NM_000547, NM_001206744, NM_001206745, NM_175719, NM_175720, NM_175721, NM_175722
Synonyms MSA; TDH2A; TPX
Summary This gene encodes a membrane-bound glycoprotein. The encoded protein acts as an enzyme and plays a central role in thyroid gland function. The protein functions in the iodination of tyrosine residues in thyroglobulin and phenoxy-ester formation between pairs of iodinated tyrosines to generate the thyroid hormones, thyroxine and triiodothyronine. Mutations in this gene are associated with several disorders of thyroid hormonogenesis, including congenital hypothyroidism, congenital goiter, and thyroid hormone organification defect IIA. Multiple transcript variants encoding distinct isoforms have been identified for this gene, but the full-length nature of some variants has not been determined. [provided by RefSeq, May 2011]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (5)

Documents

Other Versions

Customer Reviews 
Loading...