Human SREBP1 (SREBF1) activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	SREBF1
Locus ID	6720
Kit Components	GA104618G1, SREBP1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGAGATTTGTGGCGCAGACC GA104618G2, SREBP1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCGGGGCCGTCTATCTGGGA GA104618G3, SREBP1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CAATGGCAGCGGCCTCTGGC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_001005291, NM_001321096, NM_004176
Synonyms	bHLHd1; SREBP-1c; SREBP1; SREBP1a
Summary	This gene encodes a basic helix-loop-helix-leucine zipper (bHLH-Zip) transcription factor that binds to the sterol regulatory element-1 (SRE1), which is a motif that is found in the promoter of the low density lipoprotein receptor gene and other genes involved in sterol biosynthesis. The encoded protein is synthesized as a precursor that is initially attached to the nuclear membrane and endoplasmic reticulum. Following cleavage, the mature protein translocates to the nucleus and activates transcription. This cleaveage is inhibited by sterols. This gene is located within the Smith-Magenis syndrome region on chromosome 17. Alternative promoter usage and splicing result in multiple transcript variants, including SREBP-1a and SREBP-1c, which correspond to RefSeq transcript variants 2 and 3, respectively. [provided by RefSeq, Nov 2017]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.