Human Polycystin 2 (PKD2) activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	PKD2
Locus ID	5311
Kit Components	GA103573G1, Polycystin 2 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TTCTGCCTCGATTCACCAAA GA103573G2, Polycystin 2 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCCAAGAGTTATCTCAGCGT GA103573G3, Polycystin 2 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCCACTTGGAACGCGGACTC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Reference Data
RefSeq	NM_000297, NR_156488
Synonyms	APKD2; Pc-2; PC2; PKD4; TRPP2
Summary	This gene encodes a member of the polycystin protein family. The encoded protein is a multi-pass membrane protein that functions as a calcium permeable cation channel, and is involved in calcium transport and calcium signaling in renal epithelial cells. This protein interacts with polycystin 1, and they may be partners in a common signaling cascade involved in tubular morphogenesis. Mutations in this gene are associated with autosomal dominant polycystic kidney disease type 2. [provided by RefSeq, Mar 2011]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.