Human Polycystin 2 (PKD2) activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	PKD2
Locus ID	5311
Kit Components	GA103573G1, Polycystin 2 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TTCTGCCTCGATTCACCAAA GA103573G2, Polycystin 2 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCCAAGAGTTATCTCAGCGT GA103573G3, Polycystin 2 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCCACTTGGAACGCGGACTC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_000297, NR_156488
Synonyms	APKD2; Pc-2; PC2; PKD4; TRPP2
Summary	This gene encodes a member of the polycystin protein family. The encoded protein is a multi-pass membrane protein that functions as a calcium permeable cation channel, and is involved in calcium transport and calcium signaling in renal epithelial cells. This protein interacts with polycystin 1, and they may be partners in a common signaling cascade involved in tubular morphogenesis. Mutations in this gene are associated with autosomal dominant polycystic kidney disease type 2. [provided by RefSeq, Mar 2011]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.