Human PD1 (PDCD1) activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	PDCD1
Locus ID	5133
Kit Components	GA103431G1, PD1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCCAGGTCAGGTTGAAGGGA GA103431G2, PD1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GAGAGTGACAGAGGCAGTGC GA103431G3, PD1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGTGAGGAGGGGGTAGGACT 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Reference Data
RefSeq	NM_005018
Synonyms	CD279; hPD-1; hPD-l; hSLE1; PD-1; PD1; SLEB2
Summary	Programmed cell death protein 1 (PDCD1) is an immune-inhibitory receptor expressed in activated T cells; it is involved in the regulation of T-cell functions, including those of effector CD8+ T cells. In addition, this protein can also promote the differentiation of CD4+ T cells into T regulatory cells. PDCD1 is expressed in many types of tumors including melanomas, and has demonstrated to play a role in anti-tumor immunity. Moreover, this protein has been shown to be involved in safeguarding against autoimmunity, however, it can also contribute to the inhibition of effective anti-tumor and anti-microbial immunity. [provided by RefSeq, Aug 2020]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.