Human PAPP A (PAPPA) activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	PAPPA
Locus ID	5069
Kit Components	GA103385G1, PAPP A gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCATGACTAATCAATCAGTT GA103385G2, PAPP A gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TTAACAGGGACTCATTCAAT GA103385G3, PAPP A gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGGGACTCATTCAATTGGGA 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_002581
Synonyms	ASBABP2; DIPLA1; IGFBP-4ase; PAPA; PAPP-A; PAPPA1
Summary	This gene encodes a secreted metalloproteinase which cleaves insulin-like growth factor binding proteins (IGFBPs). Following IGFBP cleavage, insulin growth factors dissociate from IGFBPs and bind to IGF receptors, resulting in activation of the IGF pathway. The encoded protein plays a role in bone formation, inflammation, wound healing and female fertility. Enhanced expression of this protein is associated with diabetic nephropathy in human patients and this protein may promote tumor invasion and growth in various human cancers. [provided by RefSeq, Aug 2017]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.