Human PAPP A (PAPPA) activation kit by CRISPRa
CAT#: GA103385
PAPPA CRISPRa kit - CRISPR gene activation of human pappalysin 1
CNY 12,255.00
Specifications
Product Data | |
Format | 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug) |
Symbol | PAPPA |
Locus ID | 5069 |
Kit Components | GA103385G1, PAPP A gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCATGACTAATCAATCAGTT GA103385G2, PAPP A gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TTAACAGGGACTCATTCAAT GA103385G3, PAPP A gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGGGACTCATTCAATTGGGA 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077 |
Reference Data | |
RefSeq | NM_002581 |
Synonyms | ASBABP2; DIPLA1; IGFBP-4ase; PAPA; PAPP-A; PAPPA1 |
Summary | This gene encodes a secreted metalloproteinase which cleaves insulin-like growth factor binding proteins (IGFBPs). Following IGFBP cleavage, insulin growth factors dissociate from IGFBPs and bind to IGF receptors, resulting in activation of the IGF pathway. The encoded protein plays a role in bone formation, inflammation, wound healing and female fertility. Enhanced expression of this protein is associated with diabetic nephropathy in human patients and this protein may promote tumor invasion and growth in various human cancers. [provided by RefSeq, Aug 2017] |
Documents
Resources
基因表达相关资源 |
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
KN209767 | PAPPA - human gene knockout kit via CRISPR, HDR mediated |
CNY 12,260.00 |
|
KN209767BN | PAPPA - human gene knockout kit via CRISPR, HDR mediated |
CNY 12,260.00 |
|
KN209767LP | PAPPA - human gene knockout kit via CRISPR, HDR mediated |
CNY 12,260.00 |
|
KN209767RB | PAPPA - human gene knockout kit via CRISPR, HDR mediated |
CNY 12,260.00 |
|
KN409767 | PAPPA - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. |
CNY 8,680.00 |