Human Oxytocin neurophysin 1 (OXT) activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	OXT
Locus ID	5020
Kit Components	GA103350G1, Oxytocin neurophysin 1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCACTAGAATATAAGCCCCA GA103350G2, Oxytocin neurophysin 1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCCTTTTATCTCTGTAGCAC GA103350G3, Oxytocin neurophysin 1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: ATGTCCCCTCAGATATCTGC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_000915
Synonyms	OT; OT-NPI; OXT-NPI
Summary	This gene encodes a precursor protein that is processed to produce oxytocin and neurophysin I. Oxytocin is a posterior pituitary hormone which is synthesized as an inactive precursor in the hypothalamus along with its carrier protein neurophysin I. Together with neurophysin, it is packaged into neurosecretory vesicles and transported axonally to the nerve endings in the neurohypophysis, where it is either stored or secreted into the bloodstream. The precursor seems to be activated while it is being transported along the axon to the posterior pituitary. This hormone contracts smooth muscle during parturition and lactation. It is also involved in cognition, tolerance, adaptation and complex sexual and maternal behaviour, as well as in the regulation of water excretion and cardiovascular functions. [provided by RefSeq, Dec 2013]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.