Human NFIX activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	NFIX
Locus ID	4784
Kit Components	GA103191G1, NFIX gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: CTTCGAACACAAAGCACACT GA103191G2, NFIX gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CATGTCACGTCCAGAACGCC GA103191G3, NFIX gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: TGGACGTGACATGTGTGGCG 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Reference Data
RefSeq	NM_001271043, NM_001271044, NM_002501, NM_001365982, NM_001365983, NM_001365985, NM_001365902, NM_001365984
Synonyms	MRSHSS; NF1A; SOTOS2
Summary	The protein encoded by this gene is a transcription factor that binds the palindromic sequence 5'-TTGGCNNNNNGCCAA-3 in viral and cellular promoters. The encoded protein can also stimulate adenovirus replication in vitro. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2012]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.