Human Neurofibromin (NF1) activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	NF1
Locus ID	4763
Kit Components	GA103178G1, Neurofibromin gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGTCTAGGTGAGCCCCACGG GA103178G2, Neurofibromin gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGTTAGATGACGTCACCTCC GA103178G3, Neurofibromin gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: AATGAAAAAGCGAGTCCTCC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_000267, NM_001042492, NM_001128147
Synonyms	NFNS; VRNF; WSS
Summary	This gene product appears to function as a negative regulator of the ras signal transduction pathway. Mutations in this gene have been linked to neurofibromatosis type 1, juvenile myelomonocytic leukemia and Watson syndrome. The mRNA for this gene is subject to RNA editing (CGA>UGA->Arg1306Term) resulting in premature translation termination. Alternatively spliced transcript variants encoding different isoforms have also been described for this gene. [provided by RefSeq, Jul 2008]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.