Human c-Myc (MYC) activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	MYC
Locus ID	4609
Kit Components	GA103055G1, c-Myc gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: ATTATGTATGCACAGCTATC GA103055G2, c-Myc gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCTGCTTTGGCAGCAAATTG GA103055G3, c-Myc gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CAAATTGGGGGACTCAGTCT 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_002467, NM_001354870
Synonyms	bHLHe39; c-Myc; MRTL; MYCC
Summary	This gene is a proto-oncogene and encodes a nuclear phosphoprotein that plays a role in cell cycle progression, apoptosis and cellular transformation. The encoded protein forms a heterodimer with the related transcription factor MAX. This complex binds to the E box DNA consensus sequence and regulates the transcription of specific target genes. Amplification of this gene is frequently observed in numerous human cancers. Translocations involving this gene are associated with Burkitt lymphoma and multiple myeloma in human patients. There is evidence to show that translation initiates both from an upstream, in-frame non-AUG (CUG) and a downstream AUG start site, resulting in the production of two isoforms with distinct N-termini. [provided by RefSeq, Aug 2017]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.