Human c-Myc (MYC) activation kit by CRISPRa
CAT#: GA103055
MYC CRISPRa kit - CRISPR gene activation of human MYC proto-oncogene, bHLH transcription factor
CNY 12,255.00
CNY 1,999.00
CNY 2,700.00
CNY 5,488.00
CNY 2,700.00
CNY 3,790.00
Specifications
Product Data | |
Format | 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug) |
Symbol | MYC |
Locus ID | 4609 |
Kit Components | GA103055G1, c-Myc gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: ATTATGTATGCACAGCTATC GA103055G2, c-Myc gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCTGCTTTGGCAGCAAATTG GA103055G3, c-Myc gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CAAATTGGGGGACTCAGTCT 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077 |
Reference Data | |
RefSeq | NM_002467, NM_001354870 |
Synonyms | bHLHe39; c-Myc; MRTL; MYCC |
Summary | This gene is a proto-oncogene and encodes a nuclear phosphoprotein that plays a role in cell cycle progression, apoptosis and cellular transformation. The encoded protein forms a heterodimer with the related transcription factor MAX. This complex binds to the E box DNA consensus sequence and regulates the transcription of specific target genes. Amplification of this gene is frequently observed in numerous human cancers. Translocations involving this gene are associated with Burkitt lymphoma and multiple myeloma in human patients. There is evidence to show that translation initiates both from an upstream, in-frame non-AUG (CUG) and a downstream AUG start site, resulting in the production of two isoforms with distinct N-termini. [provided by RefSeq, Aug 2017] |
Documents
Resources
基因表达相关资源 |
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
KN201611 | MYC - human gene knockout kit via CRISPR, HDR mediated |
CNY 12,260.00 |
|
KN201611BN | MYC - human gene knockout kit via CRISPR, HDR mediated |
CNY 12,260.00 |
|
KN201611LP | MYC - human gene knockout kit via CRISPR, HDR mediated |
CNY 12,260.00 |
|
KN201611RB | MYC - human gene knockout kit via CRISPR, HDR mediated |
CNY 12,260.00 |
|
KN401611 | MYC - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. |
CNY 8,680.00 |