Human MUC2 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	MUC2
Locus ID	4583
Kit Components	GA103033G1, MUC2 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGTCTGGTCCTTATATGTCC GA103033G2, MUC2 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCAGATGCCACACCCACCCT GA103033G3, MUC2 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCGGGTGTGTGTTGGCATTC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_002457
Synonyms	MLP; MUC-2; SMUC
Summary	This gene encodes a member of the mucin protein family. Mucins are high molecular weight glycoproteins produced by many epithelial tissues. The protein encoded by this gene is secreted and forms an insoluble mucous barrier that protects the gut lumen. The protein polymerizes into a gel of which 80% is composed of oligosaccharide side chains by weight. The protein features a central domain containing tandem repeats rich in threonine and proline that varies between 50 and 115 copies in different individuals. Downregulation of this gene has been observed in patients with Crohn disease and ulcerative colitis. [provided by RefSeq, Oct 2016]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.