Human GEM activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	GEM
Locus ID	2669
Kit Components	GA101781G1, GEM gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCAAAGCACTTGCGAGCTGT GA101781G2, GEM gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: AACTCGGAGTTGCAGCCACT GA101781G3, GEM gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GACGTCACGGAAAAGCCCCG 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_005261, NM_181702
Synonyms	KIR
Summary	The protein encoded by this gene belongs to the RAD/GEM family of GTP-binding proteins. It is associated with the inner face of the plasma membrane and could play a role as a regulatory protein in receptor-mediated signal transduction. Alternative splicing occurs at this locus and two transcript variants encoding the same protein have been identified. [provided by RefSeq, Jul 2008]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.