Human Fatty Acid Binding Protein 5 (FABP5) activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	FABP5
Locus ID	2171
Kit Components	GA101514G1, Fatty Acid Binding Protein 5 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GTTGTCAAACGGAGGGGTGC GA101514G2, Fatty Acid Binding Protein 5 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GTTGTCAAACGGAGGGGTGC GA101514G3, Fatty Acid Binding Protein 5 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCTATGCGGCCAATGGGAGG 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Reference Data
RefSeq	NM_001444
Synonyms	E-FABP; EFABP; KFABP; PA-FABP; PAFABP
Summary	This gene encodes the fatty acid binding protein found in epidermal cells, and was first identified as being upregulated in psoriasis tissue. Fatty acid binding proteins are a family of small, highly conserved, cytoplasmic proteins that bind long-chain fatty acids and other hydrophobic ligands. FABPs may play roles in fatty acid uptake, transport, and metabolism. Polymorphisms in this gene are associated with type 2 diabetes. The human genome contains many pseudogenes similar to this locus.[provided by RefSeq, Feb 2011]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.