Human Her2 (ERBB2) activation kit by CRISPRa
CAT#: GA101441
ERBB2 CRISPRa kit - CRISPR gene activation of human erb-b2 receptor tyrosine kinase 2
CNY 12,255.00
Cited in 1 publication. |
CNY 8,736.00
Specifications
Product Data | |
Format | 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug) |
Symbol | ERBB2 |
Locus ID | 2064 |
Kit Components | GA101441G1, Her2 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGCCAGGGAGAAAGGATGGC GA101441G2, Her2 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCGGTTGGTCCTGCTAGCTG GA101441G3, Her2 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGTACGCAGTCGCGGTACAC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077 |
Disclaimer | These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc. |
Reference Data | |
RefSeq | NM_001005862, NM_001289936, NM_001289937, NM_001289938, NM_004448, NR_110535 |
Synonyms | CD340; HER-2; HER-2/neu; HER2; MLN 19; NEU; NGL; TKR1 |
Summary | This gene encodes a member of the epidermal growth factor (EGF) receptor family of receptor tyrosine kinases. This protein has no ligand binding domain of its own and therefore cannot bind growth factors. However, it does bind tightly to other ligand-bound EGF receptor family members to form a heterodimer, stabilizing ligand binding and enhancing kinase-mediated activation of downstream signalling pathways, such as those involving mitogen-activated protein kinase and phosphatidylinositol-3 kinase. Allelic variations at amino acid positions 654 and 655 of isoform a (positions 624 and 625 of isoform b) have been reported, with the most common allele, Ile654/Ile655, shown here. Amplification and/or overexpression of this gene has been reported in numerous cancers, including breast and ovarian tumors. Alternative splicing results in several additional transcript variants, some encoding different isoforms and others that have not been fully characterized. [provided by RefSeq, Jul 2008] |
Citations (1)
The use of this Gene Expression has been cited in the following citations: |
---|
One-Step Preservation of Phosphoproteins and Tissue Morphology at Room Temperature for Diagnostic and Research Specimens
,null,
PLoS ONE
,PubMed ID 21858221
[ERBB2]
|
Documents
Resources
基因表达相关资源 |
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
KN212583 | ERBB2 - human gene knockout kit via CRISPR, HDR mediated |
CNY 12,260.00 |
|
KN212583BN | ERBB2 - human gene knockout kit via CRISPR, HDR mediated |
CNY 12,260.00 |
|
KN212583LP | ERBB2 - human gene knockout kit via CRISPR, HDR mediated |
CNY 12,260.00 |
|
KN212583RB | ERBB2 - human gene knockout kit via CRISPR, HDR mediated |
CNY 12,260.00 |
|
KN412583 | ERBB2 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. |
CNY 8,680.00 |