Human EGR1 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	EGR1
Locus ID	1958
Kit Components	GA101356G1, EGR1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TGAAGGGTCTGGAACGGCAC GA101356G2, EGR1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCTAATATGGCAGGACCGGC GA101356G3, EGR1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: TGGGGGGCTTCACGTCACTC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Reference Data
RefSeq	NM_001964
Synonyms	AT225; G0S30; KROX-24; NGFI-A; TIS8; ZIF-268; ZNF225
Summary	The protein encoded by this gene belongs to the EGR family of C2H2-type zinc-finger proteins. It is a nuclear protein and functions as a transcriptional regulator. The products of target genes it activates are required for differentitation and mitogenesis. Studies suggest this is a cancer suppressor gene. [provided by RefSeq, Dec 2014]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.