Human EGR1 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	EGR1
Locus ID	1958
Kit Components	GA101356G1, EGR1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TGAAGGGTCTGGAACGGCAC GA101356G2, EGR1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCTAATATGGCAGGACCGGC GA101356G3, EGR1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: TGGGGGGCTTCACGTCACTC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_001964
Synonyms	AT225; G0S30; KROX-24; NGFI-A; TIS8; ZIF-268; ZNF225
Summary	The protein encoded by this gene belongs to the EGR family of C2H2-type zinc-finger proteins. It is a nuclear protein and functions as a transcriptional regulator. The products of target genes it activates are required for differentitation and mitogenesis. Studies suggest this is a cancer suppressor gene. [provided by RefSeq, Dec 2014]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.