Human DHLAG (CD74) activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	CD74
Locus ID	972
Kit Components	GA100693G1, DHLAG gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: CAAATGTCCACTCCCTAGAC GA100693G2, DHLAG gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: ACGATCCCATTGGCTGCCCA GA100693G3, DHLAG gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: AAAGGCCAGCACGATCCCAT 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_001025158, NM_001025159, NM_004355, NR_157074, NM_001364083, NM_001364084
Synonyms	DHLAG; HLADG; Ia-GAMMA; II
Summary	The protein encoded by this gene associates with class II major histocompatibility complex (MHC) and is an important chaperone that regulates antigen presentation for immune response. It also serves as cell surface receptor for the cytokine macrophage migration inhibitory factor (MIF) which, when bound to the encoded protein, initiates survival pathways and cell proliferation. This protein also interacts with amyloid precursor protein (APP) and suppresses the production of amyloid beta (Abeta). Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Aug 2011]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.