Human CD36 activation kit by CRISPRa

CAT#: GA100670

CD36 CRISPRa kit - CRISPR gene activation of human CD36 molecule



  See Other Versions

CNY 12,255.00


货期*
4周

规格
    • 1 kit

Product images

经常一起买 (3)
Anti-CD36 mouse monoclonal antibody, clone OTI3F4 (formerly 3F4)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


CD36 (Myc-DDK-tagged)-Human CD36 molecule (thrombospondin receptor) (CD36), transcript variant 1
    • 10 ug

CNY 3,656.00
CNY 3,990.00


CD36 biotinylated mouse monoclonal detection antibody, validated for ELISA and Luminex assays
    • 50 ug

CNY 2,700.00
CNY 3,790.00

Specifications

Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol CD36
Locus ID 948
Kit Components

GA100670G1, CD36 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GATAGTAAAGAGGAAGGCTC

GA100670G2, CD36 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TAGAGCAACCATCTGTTAAC

GA100670G3, CD36 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCCCTGACACCTGAGCCAAA

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077

Reference Data
RefSeq NM_000072, NM_001001547, NM_001001548, NM_001127443, NM_001127444, NM_001289908, NM_001289909, NM_001289911, NR_110501
Synonyms BDPLT10; CHDS7; FAT; GP3B; GP4; GPIV; PASIV; SCARB3
Summary The protein encoded by this gene is the fourth major glycoprotein of the platelet surface and serves as a receptor for thrombospondin in platelets and various cell lines. Since thrombospondins are widely distributed proteins involved in a variety of adhesive processes, this protein may have important functions as a cell adhesion molecule. It binds to collagen, thrombospondin, anionic phospholipids and oxidized LDL. It directly mediates cytoadherence of Plasmodium falciparum parasitized erythrocytes and it binds long chain fatty acids and may function in the transport and/or as a regulator of fatty acid transport. Mutations in this gene cause platelet glycoprotein deficiency. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Feb 2014]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Other Versions

Customer Reviews 
Loading...