Human CD36 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	CD36
Locus ID	948
Kit Components	GA100670G1, CD36 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GATAGTAAAGAGGAAGGCTC GA100670G2, CD36 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TAGAGCAACCATCTGTTAAC GA100670G3, CD36 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCCCTGACACCTGAGCCAAA 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_000072, NM_001001547, NM_001001548, NM_001127443, NM_001127444, NM_001289908, NM_001289909, NM_001289911, NR_110501
Synonyms	BDPLT10; CHDS7; FAT; GP3B; GP4; GPIV; PASIV; SCARB3
Summary	The protein encoded by this gene is the fourth major glycoprotein of the platelet surface and serves as a receptor for thrombospondin in platelets and various cell lines. Since thrombospondins are widely distributed proteins involved in a variety of adhesive processes, this protein may have important functions as a cell adhesion molecule. It binds to collagen, thrombospondin, anionic phospholipids and oxidized LDL. It directly mediates cytoadherence of Plasmodium falciparum parasitized erythrocytes and it binds long chain fatty acids and may function in the transport and/or as a regulator of fatty acid transport. Mutations in this gene cause platelet glycoprotein deficiency. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Feb 2014]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.