Human B7-1 (CD80) activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	CD80
Locus ID	941
Kit Components	GA100663G1, B7-1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GAAACACCACGAGCACCAGG GA100663G2, B7-1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GTTTGTTAGTCCATGCACGG GA100663G3, B7-1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: TAGTCCATGCACGGTGGTGA 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_005191
Synonyms	B7; B7-1; B7.1; BB1; CD28LG; CD28LG1; LAB7
Summary	The protein encoded by this gene is a membrane receptor that is activated by the binding of CD28 or CTLA-4. The activated protein induces T-cell proliferation and cytokine production. This protein can act as a receptor for adenovirus subgroup B and may play a role in lupus neuropathy. [provided by RefSeq, Aug 2011]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.