Human ASCL1 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	ASCL1
Locus ID	429
Kit Components	GA100310G1, ASCL1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TTGAAAAGGCGGACGCACTC GA100310G2, ASCL1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CGGGAGAAAGGAACGGGAGG GA100310G3, ASCL1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: AATAAACAGGCGGCGCGCTC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_004316
Synonyms	ASH1; bHLHa46; HASH1; MASH1
Summary	This gene encodes a member of the basic helix-loop-helix (BHLH) family of transcription factors. The protein activates transcription by binding to the E box (5'-CANNTG-3'). Dimerization with other BHLH proteins is required for efficient DNA binding. This protein plays a role in the neuronal commitment and differentiation and in the generation of olfactory and autonomic neurons. Mutations in this gene may contribute to the congenital central hypoventilation syndrome (CCHS) phenotype in rare cases. [provided by RefSeq, Jul 2008]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.