Human ADAR1 (ADAR) activation kit by CRISPRa
CAT#: GA100067
ADAR CRISPRa kit - CRISPR gene activation of human adenosine deaminase RNA specific
CNY 12,255.00
CNY 6,281.00
CNY 10,240.00
Specifications
Product Data | |
Format | 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug) |
Symbol | ADAR |
Locus ID | 103 |
Kit Components | GA100067G1, ADAR1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: ACGGGCCATTCAAAGACTAC GA100067G2, ADAR1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GTGGTTCTTCCTCCCACGCC GA100067G3, ADAR1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCGCTGTTTTGGGTACAGTG 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077 |
Disclaimer | These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc. |
Reference Data | |
RefSeq | NM_001025107, NM_001111, NM_001193495, NM_015840, NM_015841, NM_001365046, NM_001365048, NM_001365049, NM_001365045, NM_001365047 |
Synonyms | ADAR1; AGS6; DRADA; DSH; DSRAD; G1P1; IFI-4; IFI4; K88DSRBP; P136 |
Summary | This gene encodes the enzyme responsible for RNA editing by site-specific deamination of adenosines. This enzyme destabilizes double-stranded RNA through conversion of adenosine to inosine. Mutations in this gene have been associated with dyschromatosis symmetrica hereditaria. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2010] |
Documents
Resources
基因表达相关资源 |
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
KN407522 | ADAR - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. |
CNY 8,680.00 |