RNase H1 (RNASEH1) (NM_001286834) Human Untagged Clone
CAT#: SC334892
RNASEH1 (untagged) - Human ribonuclease H1 (RNASEH1), transcript variant 1
CNY 2,950.00
货期*
3周
规格
Product images
经常一起买 (4)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | H1RNA; PEOB2; RNH1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001286834, the custom clone sequence may differ by one or more nucleotides
ATGTTCTATGCCGTGAGGAGGGGCCGCAAGACCGGGGTCTTTCTGACCTGGAATGAGTGCAGAGCACAGG TGGACCGGTTTCCTGCTGCCAGATTTAAGAAGTTTGCCACAGAGGATGAGGCCTGGGCCTTTGTCAGGAA ATCTGCAAGCCCGGAAGTTTCAGAAGGGCATGAAAATCAACATGGACAAGAATCGGAGGCGAAAGCCAGC AAGCGACTCCGTGAGCCACTGGATGGAGATGGACATGAAAGCGCAGAGCCGTATGCAAAGCACATGAAGC CGAGCGTGGAGCCGGCGCCTCCAGTTAGCAGAGACACGTTTTCCTACATGGGAGACTTCGTCGTCGTCTA CACTGATGGCTGCTGCTCCAGTAATGGGCGTAGAAGGCCGCGAGCAGGAATCGGCGTTTACTGGGGGCCA GGCCATCCTTTAAATGTAGGCATTAGACTTCCTGGGCGGCAGACAAACCAAAGAGCGGAAATTCATGCAG CCTGCAAAGCCATTGAACAAGCAAAGACTCAAAACATCAATAAACTGGTTCTGTATACAGACAGTATGTT TACGATAAATGGTATAACTAACTGGGTTCAAGGTTGGAAGAAAAATGGGTGGAAGACAAGTGCAGGGAAA GAGGTGATCAACAAAGAGGACTTTGTGGCACTGGAGAGGCTTACCCAGGGGATGGACATTCAGTGGATGC ATGTTCCTGGTCATTCGGGATTTATAGGCAATGAAGAAGCTGACAGATTAGCCAGAGAAGGAGCTAAACA ATCGGAAGACTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001286834 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001286834.1, NP_001273763.1 |
RefSeq Size | 1865 bp |
RefSeq ORF | 783 bp |
Locus ID | 246243 |
Protein Pathways | DNA replication |
Gene Summary | This gene encodes an endonuclease that specifically degrades the RNA of RNA-DNA hybrids and plays a key role in DNA replication and repair. Alternate in-frame start codon initiation results in the production of alternate isoforms that are directed to the mitochondria or to the nucleus. The production of the mitochondrial isoform is modulated by an upstream open reading frame (uORF). Mutations in this gene have been found in individuals with progressive external ophthalmoplegia with mitochondrial DNA deletions, autosomal recessive 2. Alternative splicing results in additional coding and non-coding transcript variants. Pseudogenes of this gene have been defined on chromosomes 2 and 17. [provided by RefSeq, Jul 2017] Transcript Variant: This variant (1) encodes two isoforms due to the use of alternative translation initiation codons. The longer isoform (1) is derived from the upstream AUG start codon, while the shorter isoform (2) is derived from the downstream AUG start codon. This RefSeq represents the shorter isoform (2), which is a nuclear protein (see details in PMID: 20823270). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
其它RNase H1产品
Customer
Reviews
Loading...