SOHLH2 (NM_001282147) Human Untagged Clone
CAT#: SC334606
SOHLH2 (untagged) - Human spermatogenesis and oogenesis specific basic helix-loop-helix 2 (SOHLH2), transcript variant 2
CNY 2,950.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | bHLHe81; SOSF2; SPATA28; TEB1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001282147, the custom clone sequence may differ by one or more nucleotides
ATGGCTTCCTCAATTATCTGCCAGGAGCACTGCCAGATCTCGGGCCAGGCAAAAATAGACATCTTATTAG TTGGAGATGTCACTGTGGGCTACCTGGCTGATACTGTACAGAAACTATTTGCAAACATAGCAGAAGTCAC CATCACCATCAGTGACACGAAGGAGGCAGCAGCGCTTTTGGATGATTGCATATTCAACATGGTTCTCTTG AAGGTGCCTTCTTCACTAAGTGCCGAGGAGCTGGAAGCCATCAAGTTAATTAGATTTGGCAAAAAGAAAA ATACACATTCACTGTTTGTTTTTATAATCCCTGAAAATTTTAAAGGTTGTATTTCAGGGCATGGAATGGA TATTGCTTTAACTGAACCACTGACAATGGAAAAAATGAGTAATGTGGTAAAATACTGGACAACATGTCCC TCAAACACTGTTAAGACTGAAAACGCAACTGGGCCTGAAGAACTTGGATTGCCCCTGCAGAGGTCCTACA GCGAACACCTGGGATATTTTCCTACTGATCTATTTGCCTGCTCTGAATCTTTAAGGAATGGCAATGGGCT TGAATTAAATGCTTCGTTGTCAGAGTTCGAGAAAAACAAAAAGATCTCTCTTCTTCATTCAAGCAAGGAA AAACTAAGAAGGCTGTACAGGAAGCATAGCAGCTTCTGTTTCTGGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001282147 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001282147.1, NP_001269076.1 |
RefSeq Size | 1936 bp |
RefSeq ORF | 678 bp |
Locus ID | 54937 |
UniProt ID | Q9NX45 |
Protein Families | Transcription Factors |
Gene Summary | This gene encodes one of testis-specific transcription factors which are essential for spermatogenesis, oogenesis and folliculogenesis. This gene is located on chromosome 13. The proteins encoded by this gene and another testis-specific transcription factor, SOHLH1, can form heterodimers, in addition to homodimers. There is a read-through locus (GeneID: 100526761) that shares sequence identity with this gene and the upstream CCDC169 (GeneID: 728591). Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2013] Transcript Variant: This variant (2) lacks several exons but has an alternate 3' terminal exon, compared to variant 1. The resulting isoform (2) is much shorter and has a distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC236712 | SOHLH2 (myc-DDK-tagged) - Human spermatogenesis and oogenesis specific basic helix-loop-helix 2 (SOHLH2), transcript variant 2 |
CNY 3,990.00 |
|
RG236712 | SOHLH2 (tGFP-tagged) - Human spermatogenesis and oogenesis specific basic helix-loop-helix 2 (SOHLH2), transcript variant 2 |
CNY 4,370.00 |