SOHLH2 (NM_001282147) Human Untagged Clone

CAT#: SC334606

SOHLH2 (untagged) - Human spermatogenesis and oogenesis specific basic helix-loop-helix 2 (SOHLH2), transcript variant 2



  "NM_001282147" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-SOHLH2 Antibody
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms bHLHe81; SOSF2; SPATA28; TEB1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001282147, the custom clone sequence may differ by one or more nucleotides


ATGGCTTCCTCAATTATCTGCCAGGAGCACTGCCAGATCTCGGGCCAGGCAAAAATAGACATCTTATTAG
TTGGAGATGTCACTGTGGGCTACCTGGCTGATACTGTACAGAAACTATTTGCAAACATAGCAGAAGTCAC
CATCACCATCAGTGACACGAAGGAGGCAGCAGCGCTTTTGGATGATTGCATATTCAACATGGTTCTCTTG
AAGGTGCCTTCTTCACTAAGTGCCGAGGAGCTGGAAGCCATCAAGTTAATTAGATTTGGCAAAAAGAAAA
ATACACATTCACTGTTTGTTTTTATAATCCCTGAAAATTTTAAAGGTTGTATTTCAGGGCATGGAATGGA
TATTGCTTTAACTGAACCACTGACAATGGAAAAAATGAGTAATGTGGTAAAATACTGGACAACATGTCCC
TCAAACACTGTTAAGACTGAAAACGCAACTGGGCCTGAAGAACTTGGATTGCCCCTGCAGAGGTCCTACA
GCGAACACCTGGGATATTTTCCTACTGATCTATTTGCCTGCTCTGAATCTTTAAGGAATGGCAATGGGCT
TGAATTAAATGCTTCGTTGTCAGAGTTCGAGAAAAACAAAAAGATCTCTCTTCTTCATTCAAGCAAGGAA
AAACTAAGAAGGCTGTACAGGAAGCATAGCAGCTTCTGTTTCTGGTGA


Restriction Sites SgfI-MluI     
ACCN NM_001282147
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001282147.1, NP_001269076.1
RefSeq Size 1936 bp
RefSeq ORF 678 bp
Locus ID 54937
UniProt ID Q9NX45
Protein Families Transcription Factors
Gene Summary This gene encodes one of testis-specific transcription factors which are essential for spermatogenesis, oogenesis and folliculogenesis. This gene is located on chromosome 13. The proteins encoded by this gene and another testis-specific transcription factor, SOHLH1, can form heterodimers, in addition to homodimers. There is a read-through locus (GeneID: 100526761) that shares sequence identity with this gene and the upstream CCDC169 (GeneID: 728591). Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2013]
Transcript Variant: This variant (2) lacks several exons but has an alternate 3' terminal exon, compared to variant 1. The resulting isoform (2) is much shorter and has a distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...