PDK2 (NM_001199900) Human Untagged Clone
CAT#: SC334402
PDK2 (untagged) - Human pyruvate dehydrogenase kinase, isozyme 2 (PDK2), transcript variant 4
CNY 2,950.00
货期*
3周
规格
Product images
经常一起买 (4)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | PDHK2; PDKII |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001199900, the custom clone sequence may differ by one or more nucleotides
ATGCGCTGGGTGTGGGCGCTGCTGAAGAATGCGTCCCTGGCAGGGGCGCCCAAGTACATAGAGCACTTCA GCAAGTTCTCCCCGTCCCCGCTGTCCATGAAGCAGTTTCTGGACTTCGGATCCAGCAATGCCTGTGAGAA AACCTCCTTCACCTTCCTCAGGCAGGAGCTGCCTGTGCGCCTGGCCAACATCATGAAAGAGATCAACCTG CTTCCCGACCGAGTGCTGAGCACACCCTCCGTGCAGCTGGTGCAGAGCTGGTATGTCCAGAGCCTCCTGG ACATCATGGAGTTCCTGGACAAGGATCCCGAGGACCATCGCACCCTGAGCCAGTTCACTGACGCCCTGGT CACCATCCGGAACCGGCACAACGACGTGGTGCCCACCATGGCACAAGGCGTGCTTGAGTACAAGGACACC TACGGCGATGACCCCGTCTCCAACCAGAACATCCAGTACTTCCTGGACCGCTTCTACCTCAGCCGCATCT CCATCCGCATGCTCATCAACCAGCACAGTGGGTGCCGGCCACAGCGGCGGGGAGCGGGCGGTGGGGGGGG CGGTGCTGGGGCCCAGGGCCGGGCTGCTGAGGGGACCTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001199900 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001199900.1, NP_001186829.1 |
RefSeq Size | 987 bp |
RefSeq ORF | 600 bp |
Locus ID | 5164 |
Protein Families | Druggable Genome, Protein Kinase |
Gene Summary | This gene encodes a member of the pyruvate dehydrogenase kinase family. The encoded protein phosphorylates pyruvate dehydrogenase, down-regulating the activity of the mitochondrial pyruvate dehydrogenase complex. Overexpression of this gene may play a role in both cancer and diabetes. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2010] Transcript Variant: This variant (4) lacks a splice site in the 3' coding region, compared to variant 1. This results in a shorter protein with a distinct C-terminus (isoform 3), compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...