C1RL (NM_001297643) Human Untagged Clone

CAT#: SC334295

C1RL (untagged) - Human complement component 1, r subcomponent-like (C1RL), transcript variant 4



  "NM_001297643" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-C1RL Antibody
    • 50 ug

CNY 5,250.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms C1r-LP; C1RL1; C1RLP; CLSPa
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001297643, the custom clone sequence may differ by one or more nucleotides


ATGCCTGGACCCAGAGTGTGGGGGAAATATCTCTGGAGAAGCCCTCACTCCAAAGGCTGTCCAGGCGCAA
TGTGGTGGCTGCTTCTCTGGGGAGTCCTCCAGGCTTGCCCAACCCGGGGCTCCGTCCTCTTGGCCCAAGA
GCTACCCCAGCAGCTGACATCCCCCGGGTACCCAGAGCCGTATGGCAAAGGCCAAGAGAGCAGCACGGAC
ATCAAGGCTCCAGAGGGCTTTGCTGTGAGGCTCGTCTTCCAGGACTTCGACCTGGAGCCGTCCCAGGACT
GTGCAGGGGACTCTGTCACAATCTCATTCGTCGGTTCGGATCCAAGCCAGTTCTGTGGTCAGCAAGGCTC
CCCTCTGGGCAGGCCCCCTGGTCAGAGGGAGTTTGTATCCTCAGGGAGGAGTTTGCGGCTGACCTTCCGC
ACACAGCCTTCCTCGGAGAACAAGACTGCCCACCTCCACAAGGGCTTCCTGGCCCTCTACCAAACCGTGG
GTGAGTGTCCCTCCTGGGGGTGCAGGGAGGGAGCCTCTGTTCCCAGCCATGACCCTGGTATCTTCAAGCC
TTAA


Restriction Sites SgfI-MluI     
ACCN NM_001297643
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001297643.1, NP_001284572.1
RefSeq Size 895 bp
RefSeq ORF 564 bp
Locus ID 51279
Protein Families Druggable Genome, Protease
Gene Summary Mediates the proteolytic cleavage of HP/haptoglobin in the endoplasmic reticulum.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (4) lacks several exons and its 3' terminal exon extends past a splice site that is used in variant 1. This results in a novel 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (4) is shorter, and has a distinct C-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...