MDFI (NM_001300805) Human Untagged Clone

CAT#: SC334271

MDFI (untagged) - Human MyoD family inhibitor (MDFI), transcript variant 2



  "NM_001300805" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


MDFI rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms I-MF; I-mfa
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001300805, the custom clone sequence may differ by one or more nucleotides


ATGTACCAGGTGAGCGGCCAGCGCCCCTCTGGCTGCGACGCGCCCTATGGAGCCCCCAGCGCAGCCCCGG
GCCCAGGCCAGCCTCAGGGGAACCCCTTGGGCTGCACCCCACTTCTGCCGAATGACTCTGGCCACCCCTC
AGAGCTGGGCGGCACCAGACGGGCGGGGAATGGTGCCCTGGGTGGCCCCAAGGCCCACCGGAAGTTGCAG
ACACACCCATCTCTCGCCAGCCAGGGCAGCAAGAAGAGTAAGAGCAGCAGCAAATCCACCACCTCCCAGA
TCCCCCTCCAGGCACAGGAAGACTGCTGTGTCCACTGCATCCTGTCCTGCCTGTTCTGCGAGTTCCTGAC
GCTGTGCAACATCGTCCTGGACTGCGCCACCTGTGGCTCCTGCAGCTCGGAGGACTCGTGCCTCTGCTGC
TGCTGCTGTGGCTCTGGCGAGTGTGCCGACTGCGACCTGCCCTGCGACCTGGACTGCGGCATCCTGGATG
CCTGCTGCGAGTCCGCGGACTGCCTGGAGATCTGCATGGAGTGCTGTGGGCTCTGCTTCTCCTCCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001300805
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001300805.1, NP_001287734.1
RefSeq Size 1451 bp
RefSeq ORF 558 bp
Locus ID 4188
UniProt ID Q99750
Protein Families Transcription Factors
Gene Summary This protein is a transcription factor that negatively regulates other myogenic family proteins. Studies of the mouse homolog, I-mf, show that it interferes with myogenic factor function by masking nuclear localization signals and preventing DNA binding. Knockout mouse studies show defects in the formation of vertebrae and ribs that also involve cartilage formation in these structures. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) differs in the 5' UTR and lacks an in-frame exon in the 5' coding region, compared to variant 1. It encodes a shorter isoform (2), compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...