C6ORF173 (CENPW) (NM_001286525) Human Untagged Clone

CAT#: SC333339

CENPW (untagged) - Human centromere protein W (CENPW), transcript variant 3



  "NM_001286525" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal CENPW Antibody
    • 100 ug

CNY 5,808.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms C6orf173; CENP-W; CUG2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC333339 representing NM_001286525.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCGCTGTCGACCATAGTCTCCCAGAGGAAGCAGATAAAGCGGAAGGCTCCCCGTGGCTTTCTAAAG
CGAGTCTTCAAGCGAAAGAAGCCTCAACTTCGTCTGGAGAAAAGTGGTGACTTATTGAAGAGTCCAGGA
CAAACGCTTGTGCGAGTAAATGTAGAGTCATTAACAAGGAGCATGTACTGGCCGCAGCAAAGGTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001286525
Insert Size 204 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001286525.1
RefSeq Size 1095 bp
RefSeq ORF 204 bp
Locus ID 387103
UniProt ID Q5EE01
MW 7.9 kDa
Gene Summary Component of the CENPA-NAC (nucleosome-associated) complex, a complex that plays a central role in assembly of kinetochore proteins, mitotic progression and chromosome segregation (By similarity). The CENPA-NAC complex recruits the CENPA-CAD (nucleosome distal) complex and may be involved in incorporation of newly synthesized CENPA into centromeres (By similarity). Part of a nucleosome-associated complex that binds specifically to histone H3-containing nucleosomes at the centromere, as opposed to nucleosomes containing CENPA. Component of the heterotetrameric CENP-T-W-S-X complex that binds and supercoils DNA, and plays an important role in kinetochore assembly. CENPW has a fundamental role in kinetochore assembly and function. It is one of the inner kinetochore proteins, with most further proteins binding downstream. Required for normal chromosome organization and normal progress through mitosis.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) uses two alternate splice sites that result in a frameshifted 3' coding region, compared to variant 1. The encoded isoform (c) has a distinct C-terminus and is shorter than isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...