PDK2 (NM_001199899) Human Untagged Clone

CAT#: SC331392

PDK2 (untagged) - Homo sapiens pyruvate dehydrogenase kinase, isozyme 2 (PDK2), transcript variant 3



  "NM_001199899" in other vectors (2)

CNY 3,330.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (4)
Anti-PDK2 Rabbit Polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms PDHK2; PDKII
Vector pCMV6-Entry
Sequence Data
>SC331392 representing NM_001199899.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGAAAGAGATCAACCTGCTTCCCGACCGAGTGCTGAGCACACCCTCCGTGCAGCTGGTGCAGAGCTGG
TATGTCCAGAGCCTCCTGGACATCATGGAGTTCCTGGACAAGGATCCCGAGGACCATCGCACCCTGAGC
CAGTTCACTGACGCCCTGGTCACCATCCGGAACCGGCACAACGACGTGGTGCCCACCATGGCACAAGGC
GTGCTTGAGTACAAGGACACCTACGGCGATGACCCCGTCTCCAACCAGAACATCCAGTACTTCCTGGAC
CGCTTCTACCTCAGCCGCATCTCCATCCGCATGCTCATCAACCAGCACACCCTCATCTTTGATGGCAGC
ACCAACCCAGCCCATCCCAAACACATCGGCAGCATCGACCCCAACTGCAACGTCTCTGAGGTGGTCAAA
GATGCCTACGACATGGCTAAGCTCCTGTGTGACAAGTATTACATGGCCTCACCTGACCTGGAGATCCAG
GAGATCAATGCAGCCAACTCCAAACAGCCGATTCACATGGTCTACGTCCCCTCCCACCTCTACCACATG
CTCTTTGAGCTCTTCAAGAATGCCATGAGGGCGACTGTGGAAAGCCATGAGTCCAGCCTCATTCTCCCA
CCCATCAAGGTCATGGTGGCCTTGGGTGAGGAAGATCTGTCCATCAAGATGAGTGACCGAGGTGGGGGT
GTTCCCTTGAGGAAGATTGAGCGACTCTTCAGCTACATGTACTCCACAGCACCCACCCCCCAGCCTGGC
ACCGGGGGAACGCCGCTGGCTGGCTTTGGTTATGGGCTCCCCATTTCCCGCCTCTACGCCAAGTACTTC
CAGGGAGACCTGCAGCTCTTCTCCATGGAAGGCTTTGGGACCGATGCTGTCATCTATCTCAAGGCCCTG
TCCACGGACTCGGTGGAGCGCCTGCCTGTCTACAACAAGTCAGCCTGGCGCCACTACCAGACCATCCAG
GAGGCCGGCGACTGGTGTGTGCCCAGCACGGAGCCCAAGAACACGTCCACGTACCGCGTCAGCTAA

Restriction Sites SgfI-MluI     
ACCN NM_001199899
Insert Size 1032 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001199899.1
RefSeq Size 2511 bp
RefSeq ORF 1032 bp
Locus ID 5164
UniProt ID Q15119
Protein Families Druggable Genome, Protein Kinase
MW 38.9 kDa
Gene Summary This gene encodes a member of the pyruvate dehydrogenase kinase family. The encoded protein phosphorylates pyruvate dehydrogenase, down-regulating the activity of the mitochondrial pyruvate dehydrogenase complex. Overexpression of this gene may play a role in both cancer and diabetes. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]
Transcript Variant: This variant (3) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (2) has a distinct N-terminus and is shorter than isoform 1. Variants 2 and 3 encode the same isoform (2).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...