GNPDA2 (NM_001270880) Human Untagged Clone

CAT#: SC330881

GNPDA2 (untagged) - Homo sapiens glucosamine-6-phosphate deaminase 2 (GNPDA2), transcript variant 2



  "NM_001270880" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal GNPDA2 Antibody
    • 100 ug

CNY 5,808.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms GNP2; SB52
Vector pCMV6-Entry
Sequence Data
>SC330881 representing NM_001270880.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGAGGCTTGTAATTCTTGATAACTATGACTTGGCTAGTGAATGGGCAGCCAAATACATCTGTAATCGC
ATCATTCAGTTCAAACCTGGACAGGACAGATATTTTACACTGGGTTTACCAACAGGACTTCCAAGAAAT
CATCCTGAAAGCTACCATTCTTATATGTGGAATAATTTTTTTAAGCATATCGATATAGATCCTAATAAT
GCACATATCCTTGACGGGAATGCTGCAGATTTACAAGCAGAATGTGATGCTTTTGAAAACAAAATAAAA
GAAGCTGGAGGAATAGATCTTTTTGTTGGAGGAATTGGTCCAGATGGTCATATCGCTTTCAATGAGCCT
GGATCCAGTTTAGTGTCAAGGACAAGATTAAAGACTCTAGCAATGGATACCATCTTGGCAAATGCCAAA
TATTTTGATGGAGATTTATCAAAAGTGCCAACTATGGCTCTAACTGTTGGTGTGGGGACAGTGATGGAT
GCTAGAGAAGTAATGATCCTTATAACAGGGGCACACAAGGCATTTGCCCTGTACAAAGCAATAGAAGAA
GGAGTCAATCACATGTGGACTGTTTCCGCTTTCCAGCAGCATCCCCGGACTATTTTTGTATGCGATGAA
GATGCTACTTTAGAATTAAGAGTTAAAACTGTGAAATACTTTAAAGGTCTAATGCATGTGCACAATAAA
CTTGTGGATCCACTATTCAGTATGAAAGATGGAAACTGA

Restriction Sites SgfI-MluI     
ACCN NM_001270880
Insert Size 729 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001270880.1
RefSeq Size 2211 bp
RefSeq ORF 729 bp
Locus ID 132789
UniProt ID Q8TDQ7
Protein Pathways Amino sugar and nucleotide sugar metabolism, Metabolic pathways
MW 27.1 kDa
Gene Summary The protein encoded by this gene is an allosteric enzyme that catalyzes the reversible reaction converting D-glucosamine-6-phosphate into D-fructose-6-phosphate and ammonium. Variations of this gene have been reported to be associated with influencing body mass index and susceptibility to obesity. A pseudogene of this gene is located on chromosome 9. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Aug 2012]
Transcript Variant: This variant (2) lacks an alternate in-frame exon in the coding region compared to variant 1. It encodes isoform 2 which is shorter than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...