A RAF (ARAF) (NM_001256197) Human Untagged Clone

CAT#: SC330383

ARAF (untagged) - Homo sapiens v-raf murine sarcoma 3611 viral oncogene homolog (ARAF), transcript variant 3



  "NM_001256197" in other vectors (2)

CNY 2950.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
ARAF mouse monoclonal antibody, clone OTI2G9 (formerly 2G9)
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms A-RAF; ARAF1; PKS2; RAFA1
Vector pCMV6-Entry
Sequence Data
>SC330383 representing NM_001256197.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGAGCCACCACGGGGCCCCCCTGCCAATGGGGCCGAGCCATCCCGGGCAGTGGGCACCGTCAAAGTA
TACCTGCCCAACAAGCAACGCACGGTGGTGACTGTCCGGGATGGCATGAGTGTCTACGACTCTCTAGAC
AAGGCCCTGAAGGTGCGGGGTCTAAATCAGGACTGCTGTGTGGTCTACCGACTCATCAAGGGACGAAAG
ACGGTCACTGCCTGGGACACAGCCATTGCTCCCCTGGATGGCGAGGAGCTCATTGTCGAGGTCCTTGAA
GATGTCCCGCTGACCATGCACAATTTTGTACGGAAGACCTTCTTCAGCCTGGCGTTCTGTGACTTCTGC
CTTAAGTTTCTGTTCCATGGCTTCCGTTGCCAAACCTGTGGCTACAAGTTCCACCAGCATTGTTCCTCC
AAGGTCCCCACAGTCTGTGTTGACATGAGTACCAACCGCCAACAGTTCTACCACAGTGTCCAGGATTTG
TCCGGAGGCTCCAGACAGCATGAGGCTCCCTCGAACCGCCCCCTGAATGAGTTGCTAACCCCCCAGGGT
CCCAGGTAG

Restriction Sites SgfI-MluI     
ACCN NM_001256197
Insert Size 561 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001256197.1
RefSeq Size 1408 bp
RefSeq ORF 561 bp
Locus ID 369
UniProt ID P10398
Protein Families Druggable Genome, Protein Kinase
Protein Pathways Acute myeloid leukemia, Bladder cancer, Chronic myeloid leukemia, Colorectal cancer, Endometrial cancer, ErbB signaling pathway, Glioma, Insulin signaling pathway, Long-term depression, Long-term potentiation, Melanoma, Natural killer cell mediated cytotoxicity, Non-small cell lung cancer, Pancreatic cancer, Pathways in cancer, Progesterone-mediated oocyte maturation, Prostate cancer, Regulation of actin cytoskeleton, Renal cell carcinoma, Vascular smooth muscle contraction
MW 20.9 kDa
Gene Summary This proto-oncogene belongs to the RAF subfamily of the Ser/Thr protein kinase family, and maybe involved in cell growth and development. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jan 2012]
Transcript Variant: This variant (3) lacks several exons and its transcription extends past a splice site that is used in variant 1, resulting in an immediate translation termination and a novel 3' UTR compared to variant 1. The resulting isoform (3) has a shorter C-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...