Dehydrodolichyl Diphosphate Synthase (DHDDS) (NM_001243565) Human Untagged Clone

CAT#: SC330147

DHDDS (untagged) - Homo sapiens dehydrodolichyl diphosphate synthase (DHDDS), transcript variant 4



  "NM_001243565" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-DHDDS Antibody
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CIT; CPT; DEDSM; DS; hCIT; HDS; RP59
Vector pCMV6-Entry
Sequence Data
>SC330147 representing NM_001243565.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTCATGGATCAAGGAAGGAGAGCTGTCACTTTGGGAGCGGTTCTGTGCCAACATCATAAAGGCAGGC
CCAATGCCGAAACACATTGCATTCATAATGGACGGGAACCGTCGCTATGCCAAGAAGTGCCAGGTGGAG
CGGCAGGAAGGCCACTCACAGGGCTTCAACAAGCTAGCTGAGACTCTGCGGTGGTGTTTGAACCTGGGC
ATCCTAGAGGTGACAGTCTACGCATTCAGCATTGAGAACTTCAAACGCTCCAAGAGTGAGGTAGACGGG
CTTATGGATCTGGCCCGGCAGAAGTTCAGCCGCTTGATGGAAGAAAAGTGTTTCCTGAATGTCTGTTTT
GCATACACATCCCGTCATGAGATCAGCAATGCTGTGAGAGAGATGGCCTGGGGGGTGGAGCAAGGCCTG
TTGGATCCCAGTGATATCTCTGAGTCTCTGCTTGATAAGTGCCTCTATACCAACCGCTCTCCTCATCCT
GACATCTTGATACGGACTTCTGGAGAAGTGCGGCTGAGTGACTTCTTGCTATGGCAGACCTCTCACTCC
TGCCTGGTGTTCCAACCCGTTCTGTGGCCAGAGTATACATTTTGGAACCTCTTCGAGGCCATCCTGCAG
TTCCAGATGAACCATAGCGTGCTTCAGAAGGCCCGAGACATGTATGCAGAGGAGCGGAAGAGGCAGCAG
CTGGAGAGGGACCAGGCTACAGTGACAGAGCAGCTGCTGCGAGAGGGGCTCCAAGCCAGTGGGGACGCC
CAGCTCCGAAGGACACGCTTGCACAAACTCTCGGCCAGACGGGAAGAGCGAGTCCAAGGCTTCCTGCAG
GCCTTGGAACTCAAGCGAGCTGACTGGCTGGCCCGTCTGGGCACTGCATCAGCCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001243565
Insert Size 885 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001243565.1
RefSeq Size 3223 bp
RefSeq ORF 885 bp
Locus ID 79947
UniProt ID Q86SQ9
Protein Pathways Terpenoid backbone biosynthesis
MW 34.3 kDa
Gene Summary The protein encoded by this gene catalyzes cis-prenyl chain elongation to produce the polyprenyl backbone of dolichol, a glycosyl carrier lipid required for the biosynthesis of several classes of glycoproteins. Mutations in this gene are associated with retinitis pigmentosa type 59. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
Transcript Variant: This variant (4) lacks an in-frame coding exon compared to variant 1. This results in a shorter isoform (4) missing an internal protein segment compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

其它Dehydrodolichyl Diphosphate Synthase产品

Customer Reviews 
Loading...