DCP2 (NM_001242377) Human Untagged Clone

CAT#: SC329943

DCP2 (untagged) - Homo sapiens decapping mRNA 2 (DCP2), transcript variant 2



  "NM_001242377" in other vectors (2)

CNY 3,710.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


DCP2 rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms NUDT20
Vector pCMV6-Entry
Sequence Data
>SC329943 representing NM_001242377.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGAGACCAAACGGGTGGAGATTCCCGGCAGCGTCCTGGACGATCTCTGCAGCCGATTTATTTTGCAT
ATTCCCAGCGAGGAAAGAGACAATGCAATCCGAGTGTGTTTTCAGATTGAACTTGCCCATTGGTTTTAC
TTGGATTTCTACATGCAGAACACACCAGGATTACCTCAGTGTGGGATAAGAGACTTTGCTAAAGCTGTC
TTCAGTCATTGTCCGTTTTTGCTGCCTCAAGGTGAAGATGTGGAAAAAGTTTTGGATGAATGGAAGGAA
TATAAAATGGGAGTACCAACATATGGTGCAATTATTCTTGATGAGACACTTGAAAATGTACTACTAGTT
CAGGGGTACCTAGCAAAATCAGGCTGGGGATTTCCAAAAGGAAAAGTAAATAAAGAAGAAGCTCCTCAT
GATTGTGCTGCTAGAGAGGTCTTTGAAGAAACTGGTTTTGATATCAAAGACTATATTTGTAAGGATGAT
TACATTGAACTTCGAATCAATGACCAGCTTGCTCGTTTGTACATCATTCCAGGAATTCCAAAAGACACA
AAATTTAACCCAAAAACTAGAAGAGAAATTCGGAACATTGAGTGGTTCTCTATTGAGAAATTGCCTTGT
CATAGAAATGATATGACCCCCAAATCCAAACTTGGTTTGGCACCTAACAAATTTTTTATGGCCATTCCC
TTTATCAGACCATTAAGGGACTGGCTTTCTCGAAGATTTGGCGATTCCTCAGACAGTGACAATGGATTT
TCCTCAACTGGTAGCACGCCGGCTAAACCCACTGTGGAAAAATTGAGTCGAACCAAATTCCGCCACAGT
CAGCAGTTATTTCCTGACGGTTCTCCTGGTGACCAGTGGGTAAAGCACAGGCAACCACTGCAGCAAAAG
CCATATAATAATCATTCTGAAATGTCTGACCTTTTAAAAGGAAAGAAGTGTGAAAAGAAACTTCATCCA
CGGAAACTTCAGGATAATTTTGAAACAGATGCTGTATATGACTTGCCTAGCTCCAGTGAAGACCAGTTG
CTAGAACATGCTGAGGGACAGCCCGTGGCATGTAATGGACATTGCAAGTTCCCCTTTTCATCCAGAGCC
TTTTTGAGTTTCAAGTTTGACCATAATGCTATAATGAAAATCTTGGACCTTTGA

Restriction Sites SgfI-MluI     
ACCN NM_001242377
Insert Size 1158 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001242377.1
RefSeq Size 10093 bp
RefSeq ORF 1158 bp
Locus ID 167227
UniProt ID Q8IU60
Protein Pathways RNA degradation
MW 44.4 kDa
Gene Summary The protein encoded by this gene is a key component of an mRNA-decapping complex required for degradation of mRNAs, both in normal mRNA turnover, and in nonsense-mediated mRNA decay (NMD). It removes the 7-methyl guanine cap structure from mRNA, prior to its degradation from the 5' end. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene.[provided by RefSeq, Jun 2011]
Transcript Variant: This variant (2) lacks an in-frame coding exon compared to variant 1. This results in a shorter isoform (2) missing an internal protein segment compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...