HCP1 (SLC46A1) (NM_001242366) Human Untagged Clone

CAT#: SC329938

SLC46A1 (untagged) - Homo sapiens solute carrier family 46 (folate transporter), member 1 (SLC46A1), transcript variant 2



  "NM_001242366" in other vectors (2)

CNY 4,024.00

CNY 4,090.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-SLC46A1 Antibody
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms G21; HCP1; PCFT
Vector pCMV6-Entry
Sequence Data
>SC329938 representing NM_001242366.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGAGGGGAGCGCGAGCCCCCCGGAAAAGCCCCGCGCCCGCCCTGCGGCTGCCGTGCTGTGCCGGGGC
CCGGTAGAGCCGCTGGTCTTCCTGGCCAACTTTGCCTTGGTCCTGCAGGGCCCGCTCACCACGCAGTAT
CTGTGGCACCGCTTCAGCGCCGACCTCGGCTACAATGGCACCCGCCAAAGGGGGGGCTGCAGCAACCGC
AGCGCGGACCCCACCATGCAGGAAGTGGAGACCCTTACCTCCCACTGGACCCTCTACATGAACGTGGGC
GGCTTCCTGGTGGGGCTCTTCTCGTCCACCCTGCTGGGAGCTTGGAGCGACAGTGTGGGCCGCCGCCCG
CTGCTAGTGCTGGCCTCGCTGGGCCTGCTGCTCCAGGCCCTAGTGTCCGTTTTTGTGGTGCAGCTGCAG
CTCCACGTCGGCTACTTCGTGCTGGGTCGCATCCTTTGTGCCCTCCTCGGCGACTTCGGTGGCCTTCTG
GCTGCTAGCTTTGCGTCCGTGGCAGATGTCAGCTCCAGTCGCAGCCGCACCTTCCGGATGGCCCTGCTG
GAAGCCAGCATCGGGGTGGCTGGGATGCTGGCAAGCCTCCTCGGGGGCCACTGGCTCCGGGCCCAGGGT
TATGCCAACCCCTTCTGGCTGGCCTTGGCCTTGCTGATAGCCATGACTCTCTATGCAGCTTTCTGCTTT
GGTGAGACCTTAAAGGAGCCAAAGTCCACCCGGCTCTTCACGTTCCGTCACCACCGATCCATTGTCCAG
CTCTATGTGGCTCCCGCCCCAGAGAAGTCCAGGAAACATTTAGCCCTCTACTCACTGGCCATCTTCGTG
GTGATCACTGTGCACTTTGGGGCCCAGGACATCTTAACCCTTTATGAACTAAGCACACCCCTCTGCTGG
GACTCCAAACTAATCGGCTATGGTTCTGCAGCTCAGCATCTCCCCTACCTCACCAGCCTGCTGGCCCTG
AAGCTCCTGCAGTACTGCCTGGCCGATGCCTGGGTAGCTGAGATCGGCCTGGCCTTCAACATCCTGGGG
ATGGTGGTCTTTGCCTTTGCCACTATCACGCCTCTCATGTTCACAGGTGCTCTCTTTTCTGCTGTGGCC
TGTGTGAATAGCCTGGCCATGCTGACGGCCTCCGGCATCTTCAACTCACTCTACCCAGCCACTCTGAAC
TTTATGAAGGGGTTCCCCTTCCTCCTGGGAGCTGGCCTCCTGCTCATCCCGGCTGTTCTGATTGGGATG
CTGGAAAAGGCTGATCCTCACCTCGAGTTCCAGCAGTTTCCCCAGAGCCCCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001242366
Insert Size 1296 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001242366.2
RefSeq Size 6426 bp
RefSeq ORF 1296 bp
Locus ID 113235
UniProt ID Q96NT5
Protein Families Transmembrane
MW 46.6 kDa
Gene Summary This gene encodes a transmembrane proton-coupled folate transporter protein that facilitates the movement of folate and antifolate substrates across cell membranes, optimally in acidic pH environments. This protein is also expressed in the brain and choroid plexus where it transports folates into the central nervous system. This protein further functions as a heme transporter in duodenal enterocytes, and potentially in other tissues like liver and kidney. Its localization to the apical membrane or cytoplasm of intestinal cells is modulated by dietary iron levels. Mutations in this gene are associated with autosomal recessive hereditary folate malabsorption disease. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2013]
Transcript Variant: This variant (2, also known as HCP-1B) lacks an in-frame coding exon compared to variant 1. This results in a shorter isoform (2) missing an internal protein segment (containing one of the transmembrane domains) compared to isoform 1. This isoform was shown to have a different subcellular localization compared to the longer isoform 1 (PMID:17947394).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...