C16orf57 (USB1) (NM_001204911) Human Untagged Clone

CAT#: SC329782

USB1 (untagged) - Homo sapiens U6 snRNA biogenesis 1 (USB1), transcript variant 3



  "NM_001204911" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
C16orf57 mouse monoclonal antibody,clone OTI1B1
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms C16orf57; hUsb1; HVSL1; Mpn1; PN
Vector pCMV6-Entry
Sequence Data
>SC329782 representing NM_001204911.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGAGCGCGGCGCCCCTGGTGGGCTACAGCAGCAGCGGCTCCGAGGATGAGTCCGAGGACGGGATGCGG
ACCAGGCCGGGGGATGGGAGCCACCGTCGTGGCCAGAGCCCCCTTCCCAGGCAGAGATTTCCAGTACCT
GACAGTGTGCTGAACATGTTCCCGGGCACCGAGGAGGGGCCTGAAGATGACAGCACAAAACACGGGGGA
CGGGTGCGCACCTTCCCCCACGAGCGAGGCAACTGGGCCACCCACGTCTATGTACCATATGAAGCCAAG
GAGGAGTTCCTGGATCTGCTTGATGTGTTGCTGCCCCATGCCCAGACATATGTCCCCCGGCTGGTAAGG
ATGAAGGTGTTCCACCTCAGCCTGTCCCAGAGTGTGGTTCTGCGCCACCACTGGATCCTCCCCTTCGTG
CAGGCTCTGAAAGCCCGTATGACCTCCTTCCACAGCCCCCATCCAGGACCTCATTGCCTCATTGGAACC
AAAGATGCCCCTGTCACCCAGGAAATTCCAAAGGATTTAGGAGCTCTGCGTCAGGAGCCAGGATCACAG
ACCAGATAA

Restriction Sites SgfI-MluI     
ACCN NM_001204911
Insert Size 561 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001204911.1
RefSeq Size 3113 bp
RefSeq ORF 561 bp
Locus ID 79650
UniProt ID Q9BQ65
MW 20.8 kDa
Gene Summary This gene encodes a protein with several conserved domains, however, its exact function is not known. Mutations in this gene are associated with poikiloderma with neutropenia (PN), which shows phenotypic overlap with Rothmund-Thomson syndrome (RTS) caused by mutations in the RECQL4 gene. It is believed that this gene product interacts with RECQL4 protein via SMAD4 proteins, explaining the partial clinical overlap between PN and RTS. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Mar 2011]
Transcript Variant: This variant (3) lacks several exons from the 3' end, and contains an alternate 3' terminal exon compared to variant 1. This results in a shorter isofom (3) with a distinct C-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...