PLSCR4 (NM_001177304) Human Untagged Clone
CAT#: SC328356
PLSCR4 (untagged)-Human phospholipid scramblase 4 (PLSCR4) transcript variant 5
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | TRA1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC328356 representing NM_001177304.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGAAAATCAAACAAAACCACCAGATCCAAGGCCTGATGCTCCTCCTGAATACAATTCTCATTTTTTA CCAGGACCCCCTGGAACAGCTGTCCCTCCACCTACTGGCTACCCAGGAGGCTTGCCTATGGGATACTAC AGTCCACAGCAACCCAGTACCTTCCCTTTGTACCAGCCAGTTGGTGGTATCCATCCTGTCCGGTATCAG CCTGGCAAATATCCTATGCCAAATCAGTCTGTTCCAATAACATGGATGCCAGGGCCAACTCCTATGGCA AACTGCCCTCCTGGTCTGGAATACTTAGTTCAGCTGGAGGTGCAGTGTCCTCCTGGTGTCACCATTGGC TTTGTTGCGGAACATTGGAACCTGTGCAGGGCGGTGTACAGCATCCAAAATGAGAAGAAAGAAAATGTG ATGAGAGTTCGTGGGCCATGCTCAACCTATGGCTGTGGTTCAGATTCTGTTTTTGAGGTCAAATCCCTT GATGGCATATCCAACATCGGCAGTATTATCCGGAAGTGGAATGGTTTGTTATCAGCAATGGCAGATGCT GACCATTTTGACATTCACTTCCCACTAGACCTGGATGTGAAGATGAAAGCCATGATTTTTGGAGCTTGC TTCCTCATTGACTTCATGTATTTTGAAAGATCTCCACCACAACGTTCAAGATAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001177304 |
Insert Size | 675 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001177304.1 |
RefSeq Size | 3014 bp |
RefSeq ORF | 675 bp |
Locus ID | 57088 |
UniProt ID | Q9NRQ2 |
MW | 24.8 kDa |
Gene Summary | May mediate accelerated ATP-independent bidirectional transbilayer migration of phospholipids upon binding calcium ions that results in a loss of phospholipid asymmetry in the plasma membrane. May play a central role in the initiation of fibrin clot formation, in the activation of mast cells and in the recognition of apoptotic and injured cells by the reticuloendothelial system.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (5) differs in the 5' UTR, lacks a portion of the 5' coding region, uses a downstream start codon, and lacks two alternate exons resulting in the loss of an in-frame segment in the central coding region, compared to variant 1. The resulting isoform (c) is shorter than isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC229718 | PLSCR4 (Myc-DDK-tagged)-Human phospholipid scramblase 4 (PLSCR4), transcript variant 5 |
CNY 2,400.00 |
|
RC229718L3 | Lenti ORF clone of Human phospholipid scramblase 4 (PLSCR4), transcript variant 5, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC229718L4 | Lenti ORF clone of Human phospholipid scramblase 4 (PLSCR4), transcript variant 5, mGFP tagged |
CNY 5,890.00 |
|
RG229718 | PLSCR4 (tGFP-tagged) - Human phospholipid scramblase 4 (PLSCR4), transcript variant 5 |
CNY 4,370.00 |