United States
Germany
Japan
United Kingdom
China
Neuro D4 (DPF1) (NM_004647) Human Untagged Clone
CAT＃: SC327816
DPF1 (untagged)-Human D4 zinc and double PHD fingers family 1 (DPF1) transcript variant 2
CNY 6,180.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | BAF45b; NEUD4; neuro-d4 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC327816 representing NM_004647.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGGCGGCCTCAGCGCCCGCCCGACCGCTGGGAGGACCGACCCGGCGGGGACCTGCTGGGGGCAGGAC CCGGGGAGCAAGATGGCCACTGTCATCCCTGGCCCCCTGAGCCTAGGCGAGGACTTCTACCGCGAGGCC ATCGAGCACTGCCGCAGTTACAACGCGCGCCTGTGCGCCGAGCGCAGCCTGCGACTGCCCTTCCTCGAC TCGCAGACCGGCGTGGCCCAGAACAACTGCTACATCTGGATGGAGAAGACCCACCGCGGGCCGGGTTTG GCCCCGGGACAGATTTACACGTACCCCGCCCGCTGTTGGAGGAAGAAACGGAGACTCAACATCCTGGAG GACCCCAGACTCAGGCCCTGCGAGTACAAGATCGACTGTGAAGCACCCCTGAAGAAGGAGGGTGGCCTC CCGGAAGGGCCGGTCCTCGAGGCTCTACTGTGTGCAGAGACGGGGGAGAAGAAGATTGAGCTGAAGGAG GAGGAGACCATTATGGACTGTCAGAAACAGCAGTTGCTGGAGTTTCCGCATGACCTCGAGGTGGAAGAC TTGGAGGATGACATTCCCAGGAGGAAGAACAGGGCCAAAGGAAAGGCATATGGCATCGGGGGTCTCCGG AAACGCCAGGACACCGCTTCCCTGGAGGACCGAGACAAGCCGTATGTCTGTGATAAGTTTTACAAAGAA TTGGCCTGGGTCCCTGAGGCACAAAGGAAACACACAGCCAAGAAGGCGCCCGACGGCACTGTCATCCCC AACGGCTACTGTGACTTCTGCCTGGGGGGCTCCAAGAAGACGGGGTGTCCCGAGGACCTCATCTCCTGT GCGGACTGTGGGCGATCAGGACACCCCTCGTGTTTACAATTCACGGTGAACATGACGGCAGCCGTGCGG ACCTACCGCTGGCAGTGCATCGAGTGCAAATCCTGCAGCCTGTGCGGAACCTCCGAGAACGACGGTGCC AGCTGGGCGGGTCTCACCCCCCAGGACCAGCTGCTGTTTTGTGATGACTGCGATCGGGGTTACCACATG TACTGCCTGAGTCCCCCCATGGCGGAGCCCCCGGAAGGGAGCTGGAGCTGTCACCTCTGTCTCCGGCAC CTGAAGGAAAAGGCTTCTGCTTACATCACCCTCACCTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_004647 |
| Insert Size | 1143 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_004647.3 |
| RefSeq Size | 2246 bp |
| RefSeq ORF | 1143 bp |
| Locus ID | 8193 |
| UniProt ID | Q92782 |
| Domains | PHD |
| Protein Families | Druggable Genome, Transcription Factors |
| MW | 42.5 kDa |
| Gene Summary | May have an important role in developing neurons by participating in regulation of cell survival, possibly as a neurospecific transcription factor. Belongs to the neuron-specific chromatin remodeling complex (nBAF complex). During neural development a switch from a stem/progenitor to a post-mitotic chromatin remodeling mechanism occurs as neurons exit the cell cycle and become committed to their adult state. The transition from proliferating neural stem/progenitor cells to post-mitotic neurons requires a switch in subunit composition of the npBAF and nBAF complexes. As neural progenitors exit mitosis and differentiate into neurons, npBAF complexes which contain ACTL6A/BAF53A and PHF10/BAF45A, are exchanged for homologous alternative ACTL6B/BAF53B and DPF1/BAF45B or DPF3/BAF45C subunits in neuron-specific complexes (nBAF). The npBAF complex is essential for the self-renewal/proliferative capacity of the multipotent neural stem cells. The nBAF complex along with CREST plays a role regulating the activity of genes essential for dendrite growth (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) lacks an alternate in-frame exon in the coding region, compared to variant 4. The encoded protein (isoform b) is shorter, compared to isoform d. Sequence Note: The RefSeq transcript and protein were derived from transcript and genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC229181 | DPF1 (Myc-DDK-tagged)-Human D4, zinc and double PHD fingers family 1 (DPF1), transcript variant 2 |
CNY 3,656.00 |
|
| RC229181L3 | Lenti ORF clone of Human D4, zinc and double PHD fingers family 1 (DPF1), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC229181L4 | Lenti ORF clone of Human D4, zinc and double PHD fingers family 1 (DPF1), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
| RG229181 | DPF1 (tGFP-tagged) - Human D4, zinc and double PHD fingers family 1 (DPF1), transcript variant 2 |
CNY 4,370.00 |
|
| SC117249 | DPF1 (untagged)-Human D4, zinc and double PHD fingers family 1 (DPF1), transcript variant 2 |
CNY 3,656.00 |
其它Neuro D4产品
