United States
Germany
Japan
United Kingdom
China
CCRL2 (NM_001130910) Human Untagged Clone
CAT＃: SC325815
CCRL2 (untagged)-Human chemokine (C-C motif) receptor-like 2 (CCRL2), transcript variant 2
CNY 3,656.00
CNY 5,800.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | ACKR5; CKRX; CRAM; CRAM-A; CRAM-B; HCR |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_001130910 edited
GCCACCATGATCTACACCCGTTTCTTAAAAGGCAGTCTGAAGATGGCCAATTACACGCTG GCACCAGAGGATGAATATGATGTCCTCATAGAAGGTGAACTGGAGAGCGATGAGGCAGAG CAATGTGACAAGTATGACGCCCAGGCACTCTCAGCCCAGCTGGTGCCATCACTCTGCTCT GCTGTGTTTGTGATCGGTGTCCTGGACAATCTCCTGGTTGTGCTTATCCTGGTAAAATAT AAAGGACTCAAACGCGTGGAAAATATCTATCTTCTAAACTTGGCAGTTTCTAACTTGTGT TTCTTGCTTACCCTGCCCTTCTGGGCTCATGCTGGGGGCGATCCCATGTGTAAAATTCTC ATTGGACTGTACTTCGTGGGCCTGTACAGTGAGACATTTTTCAATTGCCTTCTGACTGTG CAAAGGTACCTAGTGTTTTTGCACAAGGGAAACTTTTTCTCAGCCAGGAGGAGGGTGCCC TGTGGCATCATTACAAGTGTCCTGGCATGGGTAACAGCCATTCTGGCCACTTTGCCTGAA TTCGTGGTTTATAAACCTCAGATGGAAGACCAGAAATACAAGTGTGCATTTAGCAGAACT CCCTTCCTGCCAGCTGATGAGACATTCTGGAAGCATTTTCTGACTTTAAAAATGAACATT TCGGTTCTTGTCCTCCCCCTATTTATTTTTACATTTCTCTATGTGCAAATGAGAAAAACA CTAAGGTTCAGGGAGCAGAGGTATAGCCTTTTCAAGCTTGTTTTTGCCATAATGGTAGTC TTCCTTCTGATGTGGGCGCCCTACAATATTGCATTTTTCCTGTCCACTTTCAAAGAACAC TTCTCCCTGAGTGACTGCAAGAGCAGCTACAATCTGGACAAAAGTGTTCACATCACTAAA CTCATCGCCACCACCCACTGCTGCATCAACCCTCTCCTGTATGCGTTTCTTGATGGGACA TTTAGCAAATACCTCTGCCGCTGTTTCCATCTGCGTAGTAACACCCCACTTCAACCCAGG GGGCAGTCTGCACAAGGCACATCGAGGGAAGAACCTGACCATTCCACCGAAGTGTAA |
| Restriction Sites | Please inquire |
| ACCN | NM_001130910 |
| Insert Size | 1100 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001130910.1, NP_001124382.1 |
| RefSeq Size | 1612 bp |
| RefSeq ORF | 1071 bp |
| Locus ID | 9034 |
| UniProt ID | O00421 |
| Protein Families | Druggable Genome, GPCR, Transmembrane |
| Gene Summary | This gene encodes a chemokine receptor like protein, which is predicted to be a seven transmembrane protein and most closely related to CCR1. Chemokines and their receptors mediated signal transduction are critical for the recruitment of effector immune cells to the site of inflammation. This gene is expressed at high levels in primary neutrophils and primary monocytes, and is further upregulated on neutrophil activation and during monocyte to macrophage differentiation. The function of this gene is unknown. This gene is mapped to the region where the chemokine receptor gene cluster is located. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) differs in the 5' UTR and coding region, compared to variant 1, resulting in a longer isoform (2) that has a distinct N-terminus, compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC225528 | CCRL2 (Myc-DDK-tagged)-Human chemokine (C-C motif) receptor-like 2 (CCRL2), transcript variant 2 |
CNY 3,656.00 |
|
| RC225528L1 | Lenti ORF clone of Human chemokine (C-C motif) receptor-like 2 (CCRL2), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC225528L2 | Lenti ORF clone of Human chemokine (C-C motif) receptor-like 2 (CCRL2), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
| RC225528L3 | Lenti ORF clone of Human chemokine (C-C motif) receptor-like 2 (CCRL2), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC225528L4 | Lenti ORF clone of Human chemokine (C-C motif) receptor-like 2 (CCRL2), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
| RG225528 | CCRL2 (tGFP-tagged) - Human chemokine (C-C motif) receptor-like 2 (CCRL2), transcript variant 2 |
CNY 4,370.00 |
