SMAD6 (NM_001142861) Human Untagged Clone
CAT#: SC325641
SMAD6 (untagged)-Human SMAD family member 6 (SMAD6), transcript variant 2
CN¥ 3,990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | AOVD2; HsT17432; MADH6; MADH7 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC325641 representing NM_001142861.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTCCAGAATGGGCAAACCCATAGAGACACAAAAATCTCCGCCACCTCCCTACTCTCGGCTGTCTCCT CGCGACGAGTACAAGCCACTGGATCTGTCCGATTCCACATTGTCTTACACTGAAACGGAGGCTACCAAC TCCCTCATCACTGCTCCGGGTGAATTCTCAGACGCCAGCATGTCTCCGGACGCCACCAAGCCGAGCCAC TGGTGCAGCGTGGCGTACTGGGAGCACCGGACGCGCGTGGGCCGCCTCTATGCGGTGTACGACCAGGCC GTCAGCATCTTCTACGACCTACCTCAGGGCAGCGGCTTCTGCCTGGGCCAGCTCAACCTGGAGCAGCGC AGCGAGTCGGTGCGGCGAACGCGCAGCAAGATCGGCTTCGGCATCCTGCTCAGCAAGGAGCCCGACGGC GTGTGGGCCTACAACCGCGGCGAGCACCCCATCTTCGTCAACTCCCCGACGCTGGACGCGCCCGGCGGC CGCGCCCTGGTCGTGCGCAAGGTGCCCCCCGGCTACTCCATCAAGGTGTTCGACTTCGAGCGCTCGGGC CTGCAGCACGCGCCCGAGCCCGACGCCGCCGACGGCCCCTACGACCCCAACAGCGTCCGCATCAGCTTC GCCAAGGGCTGGGGGCCCTGCTACTCCCGGCAGTTCATCACCTCCTGCCCCTGCTGGCTGGAGATCCTC CTCAACAACCCCAGATAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001142861 |
Insert Size | 708 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001142861.2 |
RefSeq Size | 1293 bp |
RefSeq ORF | 708 bp |
Locus ID | 4091 |
Protein Families | Cancer stem cells, Druggable Genome, ES Cell Differentiation/IPS, Transcription Factors |
Protein Pathways | TGF-beta signaling pathway |
MW | 26.2 kDa |
Gene Summary | The protein encoded by this gene belongs to the SMAD family of proteins, which are related to Drosophila 'mothers against decapentaplegic' (Mad) and C. elegans Sma. SMAD proteins are signal transducers and transcriptional modulators that mediate multiple signaling pathways. This protein functions in the negative regulation of BMP and TGF-beta/activin-signalling. Multiple transcript variants have been found for this gene.[provided by RefSeq, Sep 2014] Transcript Variant: This variant uses a different exon at the 5' terminus, compared to variant 1. The resulting isoform (2) has a shorter and distinct N-terminus with a truncated Mad homolog (MH)-1 domain, compared to isoform 1. The variant is also known as SMAD6s. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC227610 | SMAD6 (Myc-DDK-tagged)-Human SMAD family member 6 (SMAD6), transcript variant 2 |
CN¥ 3,600.00 |
|
RC227610L1 | Lenti ORF clone of Human SMAD family member 6 (SMAD6), transcript variant 2, Myc-DDK-tagged |
CN¥ 6,000.00 |
|
RC227610L2 | Lenti ORF clone of Human SMAD family member 6 (SMAD6), transcript variant 2, mGFP tagged |
CN¥ 6,000.00 |
|
RC227610L3 | Lenti ORF clone of Human SMAD family member 6 (SMAD6), transcript variant 2, Myc-DDK-tagged |
CN¥ 5,890.00 |
|
RC227610L4 | Lenti ORF clone of Human SMAD family member 6 (SMAD6), transcript variant 2, mGFP tagged |
CN¥ 5,890.00 |
|
RG227610 | SMAD6 (tGFP-tagged) - Human SMAD family member 6 (SMAD6), transcript variant 2 |
CN¥ 4,370.00 |