United States
Germany
Japan
United Kingdom
China
PTPMT1 (NM_001143984) Human Untagged Clone
CAT＃: SC325521
PTPMT1 (untagged)-Human protein tyrosine phosphatase, mitochondrial 1 (PTPMT1), nuclear gene encoding mitochondrial protein, transcript variant 2
CNY 1,200.00
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | DUSP23; MOSP; PLIP; PNAS-129 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_001143984 edited
CTGCGCCGGGCCGGGATGGCGGCCACCGCGCTGCTGGAGGCCGGCCTGGCGCGGGTGCTC TTCTACCCGACGCTGCTCTACACCCTGTTCCGCGGGAAGGTGCCGGGTCGGGCGCACCGG GACTGGTACCACCGCATCGACCCCACCGTGCTGCTGGGCGCGCTGCCGTTGCGGAGCTTG ACGCGCCAGGTGAGCCGGGCCGGGGAGCCCGGGCCCCTGCCCCGTCCCCGCCGCTCCGTC CCTGTCGGGCCGCTGGGGTCTCCACCGTCTTTGCTGAGCCACCTCTTTGCCTCGGCAGCT GGTACAGGACGAGAACGTGCGCGGGGTGATCACCATGAACGAGGAGTACGAGACGAGGTT CCTGTGCAACTCTTCACAGGTGCACAAATGGAGTCCAGAGGAGGCTGTAAGAGCCATCGC CAAGATCCGGTCATACATCCACATCAGGCCTGGCCAGCTGGATGTTCTTAA |
| Restriction Sites | Please inquire |
| ACCN | NM_001143984 |
| Insert Size | 500 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001143984.1, NP_001137456.1 |
| RefSeq Size | 2568 bp |
| RefSeq ORF | 456 bp |
| Locus ID | 114971 |
| UniProt ID | Q8WUK0 |
| Protein Families | Druggable Genome |
| Gene Summary | Lipid phosphatase which dephosphorylates phosphatidylglycerophosphate (PGP) to phosphatidylglycerol (PG) (By similarity). PGP is an essential intermediate in the biosynthetic pathway of cardiolipin, a mitochondrial-specific phospholipid regulating the membrane integrity and activities of the organelle (By similarity). Has also been shown to display phosphatase activity toward phosphoprotein substrates, specifically mediates dephosphorylation of mitochondrial proteins, thereby playing an essential role in ATP production (By similarity). Has probably a preference for proteins phosphorylated on Ser and/or Thr residues compared to proteins phosphorylated on Tyr residues (By similarity). Probably involved in regulation of insulin secretion in pancreatic beta cells (By similarity). May prevent intrinsic apoptosis, probably by regulating mitochondrial membrane integrity (PubMed:24709986).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2)reads through an intron and omits an exon, compared to variant 1. This results in a frameshift and a predicted protein with a distinct C-terminus (isoform 2). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC227174 | PTPMT1 (Myc-DDK-tagged)-Human protein tyrosine phosphatase, mitochondrial 1 (PTPMT1), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 1,200.00 |
|
| RC227174L3 | Lenti ORF clone of Human protein tyrosine phosphatase, mitochondrial 1 (PTPMT1), nuclear gene encoding mitochondrial protein, transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC227174L4 | Lenti ORF clone of Human protein tyrosine phosphatase, mitochondrial 1 (PTPMT1), nuclear gene encoding mitochondrial protein, transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
| RG227174 | PTPMT1 (tGFP-tagged) - Human protein tyrosine phosphatase, mitochondrial 1 (PTPMT1), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 4,370.00 |
